Transcript: Human XM_017009392.1

PREDICTED: Homo sapiens glutamate ionotropic receptor AMPA type subunit 1 (GRIA1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIA1 (2890)
Length:
5431
CDS:
23..2563

Additional Resources:

NCBI RefSeq record:
XM_017009392.1
NBCI Gene record:
GRIA1 (2890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061638 GCCAATCAGTTTGAGGGCAAT pLKO.1 1328 CDS 100% 4.050 5.670 N GRIA1 n/a
2 TRCN0000353436 TAATCGAGTTCTGCTACAAAT pLKO_005 2536 CDS 100% 13.200 9.240 N Gria1 n/a
3 TRCN0000061639 CCAGATTGATATTGTGAACAT pLKO.1 223 CDS 100% 4.950 3.465 N GRIA1 n/a
4 TRCN0000061640 CCAGTAAACCTGGCAGTGTTA pLKO.1 2327 CDS 100% 4.950 3.465 N GRIA1 n/a
5 TRCN0000061641 CCCTATGAATGGCACAGTGAA pLKO.1 1736 CDS 100% 4.950 3.465 N GRIA1 n/a
6 TRCN0000103048 GCGACAGCTTTGAGATGACTT pLKO.1 246 CDS 100% 4.950 3.465 N Gria1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06326 pDONR223 100% 89.1% 81.5% None (many diffs) n/a
2 ccsbBroad304_06326 pLX_304 0% 89.1% 81.5% V5 (many diffs) n/a
3 TRCN0000465270 CATAATTAAGGTCCATATACTGTT pLX_317 11.7% 89.1% 81.5% V5 (many diffs) n/a
Download CSV