Transcript: Human XM_017009443.1

PREDICTED: Homo sapiens IL2 inducible T cell kinase (ITK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITK (3702)
Length:
4065
CDS:
71..1558

Additional Resources:

NCBI RefSeq record:
XM_017009443.1
NBCI Gene record:
ITK (3702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197104 GAAGACATCAGTACCGGATTT pLKO.1 1400 CDS 100% 10.800 15.120 N ITK n/a
2 TRCN0000196768 GTGAGAACAATCCCTGTATAA pLKO.1 546 CDS 100% 13.200 9.240 N ITK n/a
3 TRCN0000010022 GGTGCCTAAATATCATCCTAA pLKO.1 43 5UTR 100% 4.950 3.465 N ITK n/a
4 TRCN0000010023 GCCTTATATGACTACCAAACC pLKO.1 227 CDS 100% 4.050 2.835 N ITK n/a
5 TRCN0000010020 TCAGTACACCAGTTCCACAGG pLKO.1 1225 CDS 100% 2.160 1.512 N ITK n/a
6 TRCN0000195263 CATCAACTATCACCAACATAA pLKO.1 652 CDS 100% 13.200 7.920 N ITK n/a
7 TRCN0000010021 CTCCACACACGTCTACCAGAT pLKO.1 1444 CDS 100% 4.050 2.430 N ITK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00886 pDONR223 100% 79.8% 79.8% None 0_1ins375 n/a
2 ccsbBroad304_00886 pLX_304 0% 79.8% 79.8% V5 0_1ins375 n/a
3 ccsbBroadEn_14676 pDONR223 0% 79.8% 79.8% None 0_1ins375 n/a
4 ccsbBroad304_14676 pLX_304 0% 79.8% 79.8% V5 0_1ins375 n/a
5 TRCN0000489937 GGCACATGTTGTATCCCCAGCACT pLX_317 23.5% 79.6% 79.7% V5 (not translated due to prior stop codon) 0_1ins375;723G>C;1485_1486insTTG n/a
Download CSV