Transcript: Human XM_017009523.2

PREDICTED: Homo sapiens poly(A) binding protein interacting protein 2 (PAIP2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAIP2 (51247)
Length:
1462
CDS:
160..543

Additional Resources:

NCBI RefSeq record:
XM_017009523.2
NBCI Gene record:
PAIP2 (51247)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432417 GGGTGAAGTACGGAAATATTT pLKO_005 521 CDS 100% 15.000 21.000 N PAIP2 n/a
2 TRCN0000153127 GAAGAGGAGTTATGGGAAGAA pLKO.1 301 CDS 100% 4.950 6.930 N PAIP2 n/a
3 TRCN0000150678 GACCAGTTTAATGACCTTGTT pLKO.1 424 CDS 100% 4.950 6.930 N PAIP2 n/a
4 TRCN0000153174 GCTACAAGTTAGTCAGCAGAT pLKO.1 1036 3UTR 100% 4.050 5.670 N PAIP2 n/a
5 TRCN0000249291 GAATTTATTGAACGCTGTTTC pLKO_005 322 CDS 100% 10.800 8.640 N Paip2 n/a
6 TRCN0000434340 GAATTTATTGAACGCTGTTTC pLKO_005 322 CDS 100% 10.800 8.640 N PAIP2 n/a
7 TRCN0000249292 GTTAGTCTTGCATGCTTAATA pLKO_005 666 3UTR 100% 15.000 10.500 N Paip2 n/a
8 TRCN0000418026 GTTAGTCTTGCATGCTTAATA pLKO_005 666 3UTR 100% 15.000 10.500 N PAIP2 n/a
9 TRCN0000219946 TTCCAACTGTTAAGCATATTT pLKO.1 906 3UTR 100% 15.000 10.500 N PAIP2 n/a
10 TRCN0000257872 ACCAAATCCAAGACCAGTTTA pLKO_005 413 CDS 100% 13.200 9.240 N Paip2 n/a
11 TRCN0000423394 GGCTAATCTATCACTTGTTAA pLKO_005 850 3UTR 100% 13.200 9.240 N PAIP2 n/a
12 TRCN0000219945 TGTGATTATTAACGGTCATTC pLKO.1 210 CDS 100% 10.800 7.560 N PAIP2 n/a
13 TRCN0000249294 TGTGATTATTAACGGTCATTC pLKO_005 210 CDS 100% 10.800 7.560 N Paip2 n/a
14 TRCN0000151781 CCAAATGCAAAGGAGTTTGTT pLKO.1 496 CDS 100% 5.625 3.938 N PAIP2 n/a
15 TRCN0000434167 ACGGTCATTCTCATGAAGATG pLKO_005 221 CDS 100% 4.950 3.465 N PAIP2 n/a
16 TRCN0000424235 CAATCCATTTGCAGAGTACAT pLKO_005 243 CDS 100% 4.950 3.465 N PAIP2 n/a
17 TRCN0000151343 GAAGAAGAGCATGAATGGTTT pLKO.1 361 CDS 100% 4.950 3.465 N PAIP2 n/a
18 TRCN0000152014 CAGACAAATAGAAGAGGAGTT pLKO.1 291 CDS 100% 4.050 2.835 N PAIP2 n/a
19 TRCN0000150863 GCAATCTGAATCCAAATGCAA pLKO.1 485 CDS 100% 3.000 2.100 N PAIP2 n/a
20 TRCN0000152692 GATCTTGTGGTCAAGAGCAAT pLKO.1 469 CDS 100% 0.495 0.347 N PAIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03253 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03253 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478712 GCTTTATTCTGTTAGGATTAGCGC pLX_317 100% 100% 100% V5 n/a
Download CSV