Transcript: Human XM_017009657.1

PREDICTED: Homo sapiens prostaglandin E receptor 4 (PTGER4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTGER4 (5734)
Length:
1116
CDS:
44..1024

Additional Resources:

NCBI RefSeq record:
XM_017009657.1
NBCI Gene record:
PTGER4 (5734)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226399 GTATTCGTCAACCAGTTATAT pLKO_005 975 CDS 100% 15.000 10.500 N PTGER4 n/a
2 TRCN0000226400 TTGGAGCGAGAAGTCAGTAAA pLKO_005 1005 CDS 100% 13.200 9.240 N PTGER4 n/a
3 TRCN0000218566 AGATGGTCATCTTACTCATTG pLKO_005 849 CDS 100% 10.800 7.560 N PTGER4 n/a
4 TRCN0000000206 CCAGTTATATCAGCCAAGTTT pLKO.1 986 CDS 100% 5.625 3.938 N PTGER4 n/a
5 TRCN0000000205 ACCAGTTATATCAGCCAAGTT pLKO.1 985 CDS 100% 4.950 3.465 N PTGER4 n/a
6 TRCN0000000207 CTCACGCTCTTTGCAGTCTAT pLKO.1 455 CDS 100% 4.950 3.465 N PTGER4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492177 TTAGAGTCATGAATGAATGACAAA pLX_317 25.9% 60.5% 58.2% V5 867_924del;978_979ins542 n/a
2 ccsbBroadEn_01332 pDONR223 100% 60.4% 58.2% None 867_924del;978_979ins544 n/a
3 ccsbBroad304_01332 pLX_304 0% 60.4% 58.2% V5 867_924del;978_979ins544 n/a
4 TRCN0000481040 TAAACACTATCCCGTGTATTGCCG pLX_317 25.9% 60.4% 58.2% V5 867_924del;978_979ins544 n/a
5 TRCN0000487702 CAACAGCCAAGACTCGGACTTCTT pLX_317 16.6% 60.4% 58.2% V5 867_924del;978_979ins544 n/a
6 TRCN0000488601 GCGCAGGACTACTCTTTGGCGTTC pLX_317 19.7% 60.4% 58.2% V5 (not translated due to prior stop codon) 867_924del;978_979ins544 n/a
Download CSV