Transcript: Human XM_017009795.2

PREDICTED: Homo sapiens treacle ribosome biogenesis factor 1 (TCOF1), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCOF1 (6949)
Length:
3576
CDS:
48..2693

Additional Resources:

NCBI RefSeq record:
XM_017009795.2
NBCI Gene record:
TCOF1 (6949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008631 CCCAAGACTAGCATCTACCAA pLKO.1 353 CDS 100% 3.000 2.400 N TCOF1 n/a
2 TRCN0000342853 CCCAAGACTAGCATCTACCAA pLKO_005 353 CDS 100% 3.000 2.400 N TCOF1 n/a
3 TRCN0000008634 CGTAACCCTTCTGGACATCTA pLKO.1 176 CDS 100% 4.950 3.465 N TCOF1 n/a
4 TRCN0000342852 CGTAACCCTTCTGGACATCTA pLKO_005 176 CDS 100% 4.950 3.465 N TCOF1 n/a
5 TRCN0000008633 GAGTCATCAGACAGCAGTGAT pLKO.1 1467 CDS 100% 4.950 3.465 N TCOF1 n/a
6 TRCN0000342854 GAGTCATCAGACAGCAGTGAT pLKO_005 1467 CDS 100% 4.950 3.465 N TCOF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07041 pDONR223 100% 91.9% 91.8% None 637_638ins231;688G>A n/a
2 ccsbBroad304_07041 pLX_304 0% 91.9% 91.8% V5 637_638ins231;688G>A n/a
3 TRCN0000478867 GCTTCCTACTTCATCTACTCCCTA pLX_317 12.6% 91.9% 91.8% V5 637_638ins231;688G>A n/a
Download CSV