Transcript: Human XM_017010022.1

PREDICTED: Homo sapiens ubiquitin domain containing 2 (UBTD2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBTD2 (92181)
Length:
3026
CDS:
269..841

Additional Resources:

NCBI RefSeq record:
XM_017010022.1
NBCI Gene record:
UBTD2 (92181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073165 CGACATAGAGACTCTGGATAT pLKO.1 538 CDS 100% 10.800 15.120 N UBTD2 n/a
2 TRCN0000073164 GCACCGCCAATCAACATGATA pLKO.1 506 CDS 100% 5.625 7.875 N UBTD2 n/a
3 TRCN0000421291 TACGCAGCAAGAGGGATGAAT pLKO_005 285 CDS 100% 5.625 7.875 N UBTD2 n/a
4 TRCN0000222605 CCACCACCCAATTCTGGATAT pLKO.1 566 CDS 100% 10.800 8.640 N UBTD2 n/a
5 TRCN0000428527 TCAGCTTCGTTTGCGCCTTTC pLKO_005 592 CDS 100% 6.000 4.800 N UBTD2 n/a
6 TRCN0000419145 ACATGAAGAGACGGTTGCATG pLKO_005 663 CDS 100% 4.050 3.240 N UBTD2 n/a
7 TRCN0000418492 GACTATGTTGTACAGGTTATA pLKO_005 779 CDS 100% 13.200 9.240 N UBTD2 n/a
8 TRCN0000436354 GATATCAGCTTCCAGTGTATT pLKO_005 480 CDS 100% 13.200 9.240 N UBTD2 n/a
9 TRCN0000430876 AGCGATTATCCTATGACAGAT pLKO_005 257 5UTR 100% 4.950 3.465 N UBTD2 n/a
10 TRCN0000073163 CCAGGCTTTGAGACTCATGTA pLKO.1 1032 3UTR 100% 4.950 3.465 N UBTD2 n/a
11 TRCN0000073167 GCAAACATAACATTACCACAT pLKO.1 422 CDS 100% 4.050 2.835 N UBTD2 n/a
12 TRCN0000176512 CCAATCAACATGATAGAGGAA pLKO.1 512 CDS 100% 2.640 1.848 N Ubtd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12976 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12976 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469554 CCACATGACCCCTGTAGCACACTT pLX_317 83.3% 100% 100% V5 n/a
Download CSV