Transcript: Human XM_017010420.2

PREDICTED: Homo sapiens adhesion G protein-coupled receptor F5 (ADGRF5), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRF5 (221395)
Length:
5784
CDS:
277..4299

Additional Resources:

NCBI RefSeq record:
XM_017010420.2
NBCI Gene record:
ADGRF5 (221395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011551 GCGACAACAATCCTGTATCTT pLKO.1 1421 CDS 100% 5.625 7.875 N ADGRF5 n/a
2 TRCN0000011552 CCTGGGAATACTCCTGGATAT pLKO.1 3297 CDS 100% 10.800 8.640 N ADGRF5 n/a
3 TRCN0000357186 AGTAACTATGATGAGGTTTAT pLKO_005 1765 CDS 100% 13.200 9.240 N ADGRF5 n/a
4 TRCN0000357188 TCCGGAAGGGTTACGGAATTT pLKO_005 890 CDS 100% 13.200 9.240 N ADGRF5 n/a
5 TRCN0000011549 CGGCTGAAGAATACACTGTTA pLKO.1 452 CDS 100% 4.950 3.465 N ADGRF5 n/a
6 TRCN0000011550 GCCATTATTAACATCCTTGAT pLKO.1 2590 CDS 100% 4.950 3.465 N ADGRF5 n/a
7 TRCN0000357187 ACCACATGTGTATAGTATTTA pLKO_005 4599 3UTR 100% 15.000 7.500 Y ADGRF5 n/a
8 TRCN0000011548 GCCCAACTTCTCTGTCTATAT pLKO.1 4641 3UTR 100% 13.200 6.600 Y ADGRF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489405 CCACGGGAACATATGGTACGAGCA pLX_317 8.4% 98.4% 98.1% V5 (many diffs) n/a
2 TRCN0000488934 ATCCCTTTCGACCTCTAAACCATC pLX_317 8.8% 98.4% 98.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV