Transcript: Human XM_017010428.1

PREDICTED: Homo sapiens kinesin family member 6 (KIF6), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF6 (221458)
Length:
1999
CDS:
91..1974

Additional Resources:

NCBI RefSeq record:
XM_017010428.1
NBCI Gene record:
KIF6 (221458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432891 AGGAATCTTGATGAGTCTATA pLKO_005 424 CDS 100% 13.200 10.560 N KIF6 n/a
2 TRCN0000422510 ACAGCGAGTGGCACTCATAAA pLKO_005 462 CDS 100% 13.200 9.240 N KIF6 n/a
3 TRCN0000413671 TCTAACAGAGGCCAAGTATAT pLKO_005 243 CDS 100% 13.200 9.240 N KIF6 n/a
4 TRCN0000116580 GTGAAGCTACAGAAAGAGTTT pLKO.1 1471 CDS 100% 4.950 3.465 N KIF6 n/a
5 TRCN0000116578 CGAAATCAATATCCTGGTCAA pLKO.1 864 CDS 100% 4.050 2.835 N KIF6 n/a
6 TRCN0000116581 CTGTGATGTGAATGCCAGGAA pLKO.1 1674 CDS 100% 2.640 1.848 N KIF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13426 pDONR223 100% 63.6% 62.7% None (many diffs) n/a
2 ccsbBroad304_13426 pLX_304 0% 63.6% 62.7% V5 (many diffs) n/a
3 TRCN0000468540 CAAGGGTATGTCCTGTGCAACCAA pLX_317 17.7% 63.6% 62.7% V5 (many diffs) n/a
4 ccsbBroadEn_13425 pDONR223 100% 41.7% 41.6% None (many diffs) n/a
5 ccsbBroad304_13425 pLX_304 0% 41.7% 41.6% V5 (many diffs) n/a
6 TRCN0000469908 GAGCAACTTGATGCCACGTCACTG pLX_317 38.8% 41.7% 41.6% V5 (many diffs) n/a
Download CSV