Transcript: Human XM_017010470.1

PREDICTED: Homo sapiens heparan sulfate-glucosamine 3-sulfotransferase 5 (HS3ST5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HS3ST5 (222537)
Length:
3806
CDS:
1095..2135

Additional Resources:

NCBI RefSeq record:
XM_017010470.1
NBCI Gene record:
HS3ST5 (222537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036396 GCCTCCAAGGATAAGTCAATA pLKO.1 1919 CDS 100% 13.200 9.240 N HS3ST5 n/a
2 TRCN0000036397 GCTCGTGGAGAAGTTCCTAAA pLKO.1 1895 CDS 100% 10.800 7.560 N HS3ST5 n/a
3 TRCN0000036394 CCCTAATACATGCGAAGTGAA pLKO.1 1742 CDS 100% 4.950 3.465 N HS3ST5 n/a
4 TRCN0000036398 GCAGTAGTCAAAGCCTCTCAA pLKO.1 1437 CDS 100% 4.950 3.465 N HS3ST5 n/a
5 TRCN0000036395 GCCTCTCAAGAAATCCACTTT pLKO.1 1449 CDS 100% 4.950 3.465 N HS3ST5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09880 pDONR223 100% 99.9% 100% None 492G>A n/a
2 ccsbBroad304_09880 pLX_304 0% 99.9% 100% V5 492G>A n/a
3 TRCN0000475882 CGCACCCCTGTGATTACCAATCCT pLX_317 37.6% 99.9% 100% V5 492G>A n/a
Download CSV