Transcript: Human XM_017010594.1

PREDICTED: Homo sapiens ubiquitin protein ligase E3 component n-recognin 2 (UBR2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBR2 (23304)
Length:
7166
CDS:
419..5767

Additional Resources:

NCBI RefSeq record:
XM_017010594.1
NBCI Gene record:
UBR2 (23304)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413906 ACGTCAAGTAGGACAACATAT pLKO_005 2062 CDS 100% 13.200 18.480 N UBR2 n/a
2 TRCN0000194615 GCCCATTGTTGGCAAAGGTAT pLKO.1 4019 CDS 100% 4.950 6.930 N Ubr2 n/a
3 TRCN0000003407 GCGTACACCATCCAAAGCATA pLKO.1 4508 CDS 100% 4.950 6.930 N UBR2 n/a
4 TRCN0000003406 GCATGGCACTACAAGAAGAAA pLKO.1 3285 CDS 100% 5.625 4.500 N UBR2 n/a
5 TRCN0000003404 GCCGGAATGTGGAGAAGAAAT pLKO.1 2489 CDS 100% 13.200 9.240 N UBR2 n/a
6 TRCN0000003403 CCTCCTTACCTTGATGACTAT pLKO.1 5582 CDS 100% 4.950 3.465 N UBR2 n/a
7 TRCN0000003405 CCTTTGTGAATGCTTGAGTAA pLKO.1 4132 CDS 100% 4.950 3.465 N UBR2 n/a
8 TRCN0000194410 CCACCCATGTTGATAGAACAT pLKO.1 2432 CDS 100% 0.495 0.396 N Ubr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07865 pDONR223 100% 23.1% 21.9% None (many diffs) n/a
2 ccsbBroad304_07865 pLX_304 0% 23.1% 21.9% V5 (many diffs) n/a
3 TRCN0000475456 GTACCCCTTTTGGGTAAATGACCA pLX_317 44.4% 23.1% 21.9% V5 (many diffs) n/a
Download CSV