Transcript: Human XM_017010779.1

PREDICTED: Homo sapiens patatin like phospholipase domain containing 1 (PNPLA1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNPLA1 (285848)
Length:
3384
CDS:
128..1315

Additional Resources:

NCBI RefSeq record:
XM_017010779.1
NBCI Gene record:
PNPLA1 (285848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078207 CCGTCAGCAAGCCTTATGTAA pLKO.1 1044 CDS 100% 5.625 7.875 N PNPLA1 n/a
2 TRCN0000078205 CGATTACTACTACCGAGGGTA pLKO.1 319 CDS 100% 2.640 3.696 N PNPLA1 n/a
3 TRCN0000078206 TGAAGACTCAAACTGGGTGAA pLKO.1 1078 CDS 100% 4.050 2.835 N PNPLA1 n/a
4 TRCN0000078204 CCTCTGGTTCATGTGAAGGAA pLKO.1 1022 CDS 100% 3.000 2.100 N PNPLA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09986 pDONR223 100% 74.3% 74.2% None 0_1ins246;737C>A;1066_1185del n/a
2 ccsbBroad304_09986 pLX_304 0% 74.3% 74.2% V5 0_1ins246;737C>A;1066_1185del n/a
3 TRCN0000465523 GTACGGACATCCGCCAAAATCTAC pLX_317 19.7% 74.3% 74.2% V5 0_1ins246;737C>A;1066_1185del n/a
4 ccsbBroadEn_09987 pDONR223 100% 72.8% 72.4% None (many diffs) n/a
5 ccsbBroad304_09987 pLX_304 0% 72.8% 72.4% V5 (many diffs) n/a
6 TRCN0000481325 TGCCGCAGGAAACGATTGATGACG pLX_317 29.7% 72.8% 72.4% V5 (many diffs) n/a
Download CSV