Transcript: Human XM_017010974.1

PREDICTED: Homo sapiens peroxisome proliferator activated receptor delta (PPARD), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPARD (5467)
Length:
3873
CDS:
447..1772

Additional Resources:

NCBI RefSeq record:
XM_017010974.1
NBCI Gene record:
PPARD (5467)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338385 ATCCACGACATCGAGACATTG pLKO_005 1083 CDS 100% 10.800 15.120 N PPARD n/a
2 TRCN0000001664 CCGCAAACCCTTCAGTGATAT pLKO.1 1406 CDS 100% 13.200 9.240 N PPARD n/a
3 TRCN0000338383 CCGCAAACCCTTCAGTGATAT pLKO_005 1406 CDS 100% 13.200 9.240 N PPARD n/a
4 TRCN0000338384 TATTCATTGCGGCCATCATTC pLKO_005 1495 CDS 100% 10.800 7.560 N PPARD n/a
5 TRCN0000001662 CCTATTCATTGCGGCCATCAT pLKO.1 1493 CDS 100% 4.950 3.465 N PPARD n/a
6 TRCN0000001661 GTATTATTTCACCAGCAGCAT pLKO.1 2131 3UTR 100% 2.640 1.848 N PPARD n/a
7 TRCN0000350911 GTATTATTTCACCAGCAGCAT pLKO_005 2131 3UTR 100% 2.640 1.848 N PPARD n/a
8 TRCN0000001663 GATCAAGAAGACCGAAACCGA pLKO.1 1703 CDS 100% 0.750 0.525 N PPARD n/a
9 TRCN0000010647 GTGTGGAAGCAGTTGGTGAAT pLKO.1 1125 CDS 100% 4.950 2.970 N PPARD n/a
10 TRCN0000350974 GTGTGGAAGCAGTTGGTGAAT pLKO_005 1125 CDS 100% 4.950 2.970 N PPARD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488417 ATGCTCAACAGCCAACGAACTGGC pLX_317 28.9% 81.7% 81.4% V5 (many diffs) n/a
2 ccsbBroadEn_06754 pDONR223 100% 81.6% 81.4% None (many diffs) n/a
3 ccsbBroad304_06754 pLX_304 0% 81.6% 81.4% V5 (many diffs) n/a
4 TRCN0000470421 CTCTATGCCAAACTACCAATACAT pLX_317 35% 81.6% 81.4% V5 (many diffs) n/a
5 TRCN0000488494 TCCCTACTTCATCTTTCGAAAGCC pLX_317 20.4% 81.6% 81.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV