Transcript: Human XM_017011026.1

PREDICTED: Homo sapiens exocyst complex component 2 (EXOC2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOC2 (55770)
Length:
2434
CDS:
167..2419

Additional Resources:

NCBI RefSeq record:
XM_017011026.1
NBCI Gene record:
EXOC2 (55770)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116104 CGGCGGAAGAAATAAAGAGAT pLKO.1 1947 CDS 100% 4.950 6.930 N EXOC2 n/a
2 TRCN0000289959 CGGCGGAAGAAATAAAGAGAT pLKO_005 1947 CDS 100% 4.950 6.930 N EXOC2 n/a
3 TRCN0000116105 GCATCAATATAATGCAGGTTT pLKO.1 2142 CDS 100% 4.950 6.930 N EXOC2 n/a
4 TRCN0000296417 CAATGTGCTTCAGCGATTTAA pLKO_005 988 CDS 100% 15.000 10.500 N EXOC2 n/a
5 TRCN0000296418 CTTGAGACACCATCAACTTTA pLKO_005 1196 CDS 100% 13.200 9.240 N EXOC2 n/a
6 TRCN0000116103 GCCTGGTATCTTATAGAGAAT pLKO.1 668 CDS 100% 4.950 3.465 N EXOC2 n/a
7 TRCN0000289958 GCCTGGTATCTTATAGAGAAT pLKO_005 668 CDS 100% 4.950 3.465 N EXOC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03652 pDONR223 100% 80.6% 80.7% None 2239A>G;2242_2248delTTAATCC;2250_2251ins529 n/a
2 ccsbBroad304_03652 pLX_304 0% 80.6% 80.7% V5 2239A>G;2242_2248delTTAATCC;2250_2251ins529 n/a
3 TRCN0000478826 TGGTCAGTCATACAACAGGCAGAC pLX_317 15.2% 80.6% 80.7% V5 2239A>G;2242_2248delTTAATCC;2250_2251ins529 n/a
Download CSV