Transcript: Human XM_017011184.1

PREDICTED: Homo sapiens solute carrier family 22 member 23 (SLC22A23), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A23 (63027)
Length:
5007
CDS:
196..1311

Additional Resources:

NCBI RefSeq record:
XM_017011184.1
NBCI Gene record:
SLC22A23 (63027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059586 CCCTGTCAGCCTTTCAATAAA pLKO.1 4219 3UTR 100% 15.000 21.000 N SLC22A23 n/a
2 TRCN0000427211 GACAGCGTCAAGGACAAATTT pLKO_005 838 CDS 100% 15.000 10.500 N SLC22A23 n/a
3 TRCN0000059585 GCTGTTGAGCAACACCTTTAT pLKO.1 3904 3UTR 100% 13.200 9.240 N SLC22A23 n/a
4 TRCN0000059587 GCTGTTCCCTTCCTGGCTAAT pLKO.1 4107 3UTR 100% 10.800 7.560 N SLC22A23 n/a
5 TRCN0000427343 TTTCCATCGTGGGCATGTTTG pLKO_005 869 CDS 100% 10.800 7.560 N SLC22A23 n/a
6 TRCN0000059583 GCAACACCTTTATGAAATGTT pLKO.1 3912 3UTR 100% 5.625 3.938 N SLC22A23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15959 pDONR223 0% 91.5% 91.6% None 0_1ins102;576A>G n/a
2 ccsbBroad304_15959 pLX_304 0% 91.5% 91.6% V5 0_1ins102;576A>G n/a
3 TRCN0000480955 TAGGGCTAGACCTGTCATTTAATA pLX_317 33% 91.5% 91.6% V5 0_1ins102;576A>G n/a
4 ccsbBroadEn_08805 pDONR223 100% 91.5% 91.6% None 0_1ins102;576A>G n/a
5 ccsbBroad304_08805 pLX_304 0% 91.5% 91.6% V5 0_1ins102;576A>G n/a
6 TRCN0000491827 CGCAGGAATATCAATACTACTTAA pLX_317 20.5% 91.5% 91.6% V5 0_1ins102;576A>G n/a
Download CSV