Transcript: Human XM_017011347.2

PREDICTED: Homo sapiens radial spoke head 3 (RSPH3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RSPH3 (83861)
Length:
6006
CDS:
473..1339

Additional Resources:

NCBI RefSeq record:
XM_017011347.2
NBCI Gene record:
RSPH3 (83861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141665 CTCAGGGATAGTGGCTACTTT pLKO.1 902 CDS 100% 5.625 7.875 N RSPH3 n/a
2 TRCN0000144756 GCTGATCGCATAATAGAAGTT pLKO.1 449 5UTR 100% 4.950 6.930 N RSPH3 n/a
3 TRCN0000143222 GTCAGCAAGCAATCAGGTAAT pLKO.1 1379 3UTR 100% 10.800 14.040 N RSPH3 n/a
4 TRCN0000121767 CCTATGCATTATGGAAACATA pLKO.1 351 5UTR 100% 5.625 3.938 N RSPH3 n/a
5 TRCN0000143442 GAACTCTTAGGGCAAGATGAA pLKO.1 1274 CDS 100% 4.950 3.465 N RSPH3 n/a
6 TRCN0000144835 GCTCTTTGACTTTGATCTTGA pLKO.1 574 CDS 100% 4.950 3.465 N RSPH3 n/a
7 TRCN0000122283 CGTGCTGAAGTTCAACGACTT pLKO.1 725 CDS 100% 4.050 2.835 N RSPH3 n/a
8 TRCN0000145136 GAGTATGAAGAACTACGGAAT pLKO.1 698 CDS 100% 4.050 2.835 N RSPH3 n/a
9 TRCN0000122888 GCTGAAGTTCAACGACTTGAA pLKO.1 728 CDS 100% 0.495 0.347 N RSPH3 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1783 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1783 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 4792 3UTR 100% 4.950 2.475 Y NPHS1 n/a
13 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4865 3UTR 100% 4.950 2.475 Y LOC339059 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1781 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1781 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1781 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4868 3UTR 100% 4.950 2.475 Y ORAI2 n/a
18 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2801 3UTR 100% 2.640 1.320 Y LINC01098 n/a
19 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3923 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04300 pDONR223 100% 51.4% 51.4% None 0_1ins816 n/a
2 ccsbBroad304_04300 pLX_304 0% 51.4% 51.4% V5 0_1ins816 n/a
3 TRCN0000478252 GCTGCGATGTTCCCGTAGCAGGTG pLX_317 21.4% 51.4% 51.4% V5 0_1ins816 n/a
4 TRCN0000492310 ATGCGCAGGGATAAGCAAAATGTG pLX_317 21.5% 51.4% 51.4% V5 (not translated due to prior stop codon) 0_1ins816 n/a
5 TRCN0000489257 TGCATTGCTGATGCGCGACCTAAA pLX_317 21.4% 51.3% 51.3% V5 0_1ins816;864_865insG n/a
Download CSV