Transcript: Human XM_017011401.2

PREDICTED: Homo sapiens RNA guanylyltransferase and 5'-phosphatase (RNGTT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNGTT (8732)
Length:
4449
CDS:
191..2002

Additional Resources:

NCBI RefSeq record:
XM_017011401.2
NBCI Gene record:
RNGTT (8732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002587 CGTCTGTGTGAGCGGTTTAAT pLKO.1 512 CDS 100% 15.000 21.000 N RNGTT n/a
2 TRCN0000284836 CGTCTGTGTGAGCGGTTTAAT pLKO_005 512 CDS 100% 15.000 21.000 N RNGTT n/a
3 TRCN0000379847 TATCGTAGCCAGCCTGTAAAT pLKO_005 2143 3UTR 100% 13.200 18.480 N RNGTT n/a
4 TRCN0000272807 GGAATCTACAAGGGTGATTAT pLKO_005 677 CDS 100% 13.200 10.560 N RNGTT n/a
5 TRCN0000284835 GTGGACTTAAACATCTTATTT pLKO_005 2201 3UTR 100% 15.000 10.500 N RNGTT n/a
6 TRCN0000002589 GCAGTGTATAGAACGAGAAAT pLKO.1 1333 CDS 100% 13.200 9.240 N RNGTT n/a
7 TRCN0000272808 GCAGTGTATAGAACGAGAAAT pLKO_005 1333 CDS 100% 13.200 9.240 N RNGTT n/a
8 TRCN0000002586 CTGAGAATACTGAGACCTTTA pLKO.1 489 CDS 100% 10.800 7.560 N RNGTT n/a
9 TRCN0000444560 TGGAATTTCCATTTCGTAAAG pLKO_005 1164 CDS 100% 10.800 7.560 N Rngtt n/a
10 TRCN0000002590 GCAGAGGCAAAGTGTAGACAT pLKO.1 3029 3UTR 100% 4.950 3.465 N RNGTT n/a
11 TRCN0000002588 GCCAAAGAAGTGAGCCATGAA pLKO.1 1478 CDS 100% 4.950 3.465 N RNGTT n/a
12 TRCN0000220491 GCCATGAAATGGATGGACTTA pLKO.1 1491 CDS 100% 4.950 3.465 N Rngtt n/a
13 TRCN0000220493 CCAGGAATCTACAAGGGTGAT pLKO.1 674 CDS 100% 4.050 2.835 N Rngtt n/a
14 TRCN0000438977 ATGTTGATTGATGGCACAAAT pLKO_005 1094 CDS 100% 13.200 7.920 N Rngtt n/a
15 TRCN0000272749 CTTCGTATGCATTTATCAAAT pLKO_005 1187 CDS 100% 13.200 7.920 N RNGTT n/a
16 TRCN0000220492 CCACTGAGAATACTGAGACAT pLKO.1 486 CDS 100% 4.950 3.465 N Rngtt n/a
17 TRCN0000081181 CCAGACCACCAGGAATCTATA pLKO.1 666 CDS 100% 13.200 7.920 N LOC436408 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07291 pDONR223 100% 98.8% 98.6% None 634C>A;1339_1356del;1799G>A n/a
2 ccsbBroad304_07291 pLX_304 0% 98.8% 98.6% V5 634C>A;1339_1356del;1799G>A n/a
3 TRCN0000481556 CATGTAGGCATCATCTGTCAAGTA pLX_317 15% 98.8% 98.6% V5 634C>A;1339_1356del;1799G>A n/a
Download CSV