Transcript: Human XM_017011403.1

PREDICTED: Homo sapiens receptor interacting serine/threonine kinase 1 (RIPK1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIPK1 (8737)
Length:
2982
CDS:
754..2280

Additional Resources:

NCBI RefSeq record:
XM_017011403.1
NBCI Gene record:
RIPK1 (8737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011403.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197069 GTAGTACTCTGGGCGATATTT pLKO.1 910 CDS 100% 15.000 21.000 N RIPK1 n/a
2 TRCN0000000706 CAGCACAAATACGAACTTCAA pLKO.1 1938 CDS 100% 4.950 6.930 N RIPK1 n/a
3 TRCN0000196958 GCAGTCTTCAGCCCATTAAAT pLKO.1 2936 3UTR 100% 15.000 10.500 N RIPK1 n/a
4 TRCN0000342657 GCAGTCTTCAGCCCATTAAAT pLKO_005 2936 3UTR 100% 15.000 10.500 N RIPK1 n/a
5 TRCN0000000707 CAGGCCAATTCCAAGTCATAT pLKO.1 1734 CDS 100% 13.200 9.240 N RIPK1 n/a
6 TRCN0000194691 CCAAGCTATCTTTGATAATAC pLKO.1 1980 CDS 100% 13.200 9.240 N RIPK1 n/a
7 TRCN0000196606 GCAAAGACCTTACGAGAATTT pLKO.1 1530 CDS 100% 13.200 9.240 N RIPK1 n/a
8 TRCN0000342656 GCAAAGACCTTACGAGAATTT pLKO_005 1530 CDS 100% 13.200 9.240 N RIPK1 n/a
9 TRCN0000194835 CCTACAATTATATGGAGATTG pLKO.1 1892 CDS 100% 10.800 7.560 N RIPK1 n/a
10 TRCN0000199741 GACGCCTCACTTAGTGGATAA pLKO.1 2309 3UTR 100% 10.800 7.560 N RIPK1 n/a
11 TRCN0000352784 GACGCCTCACTTAGTGGATAA pLKO_005 2309 3UTR 100% 10.800 7.560 N RIPK1 n/a
12 TRCN0000000705 AGGTCATGTTCTTTCAGCTTA pLKO.1 2677 3UTR 100% 4.950 3.465 N RIPK1 n/a
13 TRCN0000000709 CTTACAACAGAGAGGAGGAAA pLKO.1 1475 CDS 100% 4.950 3.465 N RIPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011403.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14910 pDONR223 82.3% 75.4% 13.1% None (many diffs) n/a
2 TRCN0000480391 GTAAAGCGGTTGTCTCGACGCCAA pLX_317 19.1% 75.4% 13.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroad304_14910 pLX_304 42% 45% 13.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV