Transcript: Human XM_017011666.1

PREDICTED: Homo sapiens receptor activity modifying protein 3 (RAMP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAMP3 (10268)
Length:
1710
CDS:
522..872

Additional Resources:

NCBI RefSeq record:
XM_017011666.1
NBCI Gene record:
RAMP3 (10268)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060980 TCCGAGTTCATCGTGTACTAT pLKO.1 603 CDS 100% 5.625 7.875 N RAMP3 n/a
2 TRCN0000060978 CATCGTGTACTATGAGAGTTT pLKO.1 611 CDS 100% 4.950 6.930 N RAMP3 n/a
3 TRCN0000060979 CTGATCGTTATACCCGTCGTT pLKO.1 789 CDS 100% 2.640 3.696 N RAMP3 n/a
4 TRCN0000060982 GAAGGCTTTCGCAGACATGAT pLKO.1 548 CDS 100% 4.950 3.465 N RAMP3 n/a
5 TRCN0000431169 TGCAACGAGACAGGCATGTTG pLKO_005 507 5UTR 100% 4.950 3.465 N RAMP3 n/a
6 TRCN0000424919 GGACTAGGACTCCTTGCTTGA pLKO_005 1260 3UTR 100% 4.050 2.835 N RAMP3 n/a
7 TRCN0000060981 CGAGGTTCTCATCCCGCTGAT pLKO.1 773 CDS 100% 1.350 0.945 N RAMP3 n/a
8 TRCN0000426265 GCCTACATCCAGGCAGAAAGA pLKO_005 1328 3UTR 100% 4.950 2.970 N RAMP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02377 pDONR223 100% 78.3% 78.3% None 0_1ins96 n/a
2 ccsbBroad304_02377 pLX_304 0% 78.3% 78.3% V5 0_1ins96 n/a
3 TRCN0000473954 CCATGTGTATGGAGCAGTTCGGAC pLX_317 71.9% 78.3% 78.3% V5 0_1ins96 n/a
4 TRCN0000489196 GACACCGGACTCAGCGCACGGTTG pLX_317 85.2% 78.2% 77.8% V5 0_1ins96;348_349insG n/a
5 TRCN0000489821 GGGCGTACGCGACCCTGCACCCTT pLX_317 72.5% 78.3% 78.3% V5 (not translated due to prior stop codon) 0_1ins96 n/a
6 ccsbBroadEn_07581 pDONR223 100% 78.1% 77.7% None 1_1delAins97 n/a
7 ccsbBroad304_07581 pLX_304 0% 78.1% 77.7% V5 1_1delAins97 n/a
Download CSV