Transcript: Human XM_017011727.1

PREDICTED: Homo sapiens deltex E3 ubiquitin ligase 2 (DTX2), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DTX2 (113878)
Length:
2372
CDS:
251..1978

Additional Resources:

NCBI RefSeq record:
XM_017011727.1
NBCI Gene record:
DTX2 (113878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257228 CGGGACCATCCTCATAGTTTA pLKO_005 1618 CDS 100% 13.200 18.480 N DTX2 n/a
2 TRCN0000237865 CAGAGATGGACCGCAACATTA pLKO_005 1863 CDS 100% 13.200 9.240 N DTX2 n/a
3 TRCN0000004558 CGGCAATAAGGATGGAAGTCT pLKO.1 1489 CDS 100% 3.000 2.100 N DTX2 n/a
4 TRCN0000004561 GCAACGGCAATAAGGATGGAA pLKO.1 1485 CDS 100% 3.000 2.100 N DTX2 n/a
5 TRCN0000237864 GCTTAGGATGCAGCTACCTCA pLKO_005 2189 3UTR 100% 2.640 1.848 N DTX2 n/a
6 TRCN0000004559 CAAGACAGAGATGGACCGCAA pLKO.1 1858 CDS 100% 2.160 1.512 N DTX2 n/a
7 TRCN0000237863 CAGAGCCAGAGCAGGTCATAA pLKO_005 1281 CDS 100% 13.200 6.600 Y DTX2 n/a
8 TRCN0000237866 CATGTACTGCAACGGCAATAA pLKO_005 1477 CDS 100% 13.200 6.600 Y DTX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09391 pDONR223 100% 92.3% 92.4% None 438C>G;504C>T;1010_1011ins141 n/a
2 ccsbBroad304_09391 pLX_304 0% 92.3% 92.4% V5 438C>G;504C>T;1010_1011ins141 n/a
3 TRCN0000471473 ATTTTGGCTCATCCCTCGGTGGAC pLX_317 24.2% 92.3% 92.4% V5 438C>G;504C>T;1010_1011ins141 n/a
Download CSV