Transcript: Human XM_017011821.1

PREDICTED: Homo sapiens enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2), transcript variant X25, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EZH2 (2146)
Length:
2854
CDS:
672..2585

Additional Resources:

NCBI RefSeq record:
XM_017011821.1
NBCI Gene record:
EZH2 (2146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039040 CGGCTCCTCTAACCATGTTTA pLKO.1 1877 CDS 100% 13.200 18.480 N Ezh2 n/a
2 TRCN0000301834 CGGCTCCTCTAACCATGTTTA pLKO_005 1877 CDS 100% 13.200 18.480 N Ezh2 n/a
3 TRCN0000040077 CCCAACATAGATGGACCAAAT pLKO.1 1128 CDS 100% 10.800 15.120 N EZH2 n/a
4 TRCN0000286291 CCCAACATAGATGGACCAAAT pLKO_005 1128 CDS 100% 10.800 15.120 N EZH2 n/a
5 TRCN0000039043 GCTGACCATTGGGACAGTAAA pLKO.1 2115 CDS 100% 13.200 10.560 N Ezh2 n/a
6 TRCN0000040075 CCAACACAAGTCATCCCATTA pLKO.1 618 5UTR 100% 10.800 8.640 N EZH2 n/a
7 TRCN0000010474 CAACACAAGTCATCCCATTAA pLKO.1 619 5UTR 100% 13.200 9.240 N EZH2 n/a
8 TRCN0000040076 CGGAAATCTTAAACCAAGAAT pLKO.1 323 5UTR 100% 5.625 3.938 N EZH2 n/a
9 TRCN0000286290 CGGAAATCTTAAACCAAGAAT pLKO_005 323 5UTR 100% 5.625 3.938 N EZH2 n/a
10 TRCN0000040074 GCTAGGTTAATTGGGACCAAA pLKO.1 1707 CDS 100% 4.950 3.465 N EZH2 n/a
11 TRCN0000286224 GCTAGGTTAATTGGGACCAAA pLKO_005 1707 CDS 100% 4.950 3.465 N EZH2 n/a
12 TRCN0000018365 TATGATGGTTAACGGTGATCA pLKO.1 2441 CDS 100% 4.950 3.465 N EZH2 n/a
13 TRCN0000353069 TATGATGGTTAACGGTGATCA pLKO_005 2441 CDS 100% 4.950 3.465 N EZH2 n/a
14 TRCN0000010475 GAAACAGCTGCCTTAGCTTCA pLKO.1 2613 3UTR 100% 4.050 2.835 N EZH2 n/a
15 TRCN0000293738 GAAACAGCTGCCTTAGCTTCA pLKO_005 2613 3UTR 100% 4.050 2.835 N EZH2 n/a
16 TRCN0000040073 TATTGCCTTCTCACCAGCTGC pLKO.1 2745 3UTR 100% 2.160 1.512 N EZH2 n/a
17 TRCN0000286227 TATTGCCTTCTCACCAGCTGC pLKO_005 2745 3UTR 100% 2.160 1.512 N EZH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00526 pDONR223 100% 84.8% 84.6% None 0_1ins327;565_566insGTAAGTGCAATTATT n/a
2 ccsbBroad304_00526 pLX_304 0% 84.8% 84.6% V5 0_1ins327;565_566insGTAAGTGCAATTATT n/a
3 TRCN0000467064 TCGGACAAAATCTCATTTTCATAA pLX_317 17.6% 84.8% 84.6% V5 0_1ins327;565_566insGTAAGTGCAATTATT n/a
Download CSV