Transcript: Human XM_017012703.1

PREDICTED: Homo sapiens inner mitochondrial membrane peptidase subunit 2 (IMMP2L), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IMMP2L (83943)
Length:
7350
CDS:
406..960

Additional Resources:

NCBI RefSeq record:
XM_017012703.1
NBCI Gene record:
IMMP2L (83943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046677 CGTGGTCACATCTGGGTTGAA pLKO.1 832 CDS 100% 4.950 6.930 N IMMP2L n/a
2 TRCN0000296731 ACCCAGAACAGAAGATCATTA pLKO_005 740 CDS 100% 13.200 9.240 N IMMP2L n/a
3 TRCN0000046673 CCGTGGTGACATTGTATCATT pLKO.1 621 CDS 100% 5.625 3.938 N IMMP2L n/a
4 TRCN0000307219 CCGTGGTGACATTGTATCATT pLKO_005 621 CDS 100% 5.625 3.938 N IMMP2L n/a
5 TRCN0000046675 TGGCAAGAGTAGAAGGAGCAT pLKO.1 512 CDS 100% 2.640 1.584 N IMMP2L n/a
6 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4119 3UTR 100% 13.200 6.600 Y IQCC n/a
7 TRCN0000221992 GCTCTTGAAGGAGATATTGTA pLKO.1 772 CDS 100% 5.625 3.938 N Immp2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12764 pDONR223 100% 57.6% 56.5% None (many diffs) n/a
2 ccsbBroad304_12764 pLX_304 0% 57.6% 56.5% V5 (many diffs) n/a
3 TRCN0000468009 ATAAATATGGCGTGATTGGTGGTA pLX_317 100% 57.6% 56.5% V5 (many diffs) n/a
Download CSV