Transcript: Human XM_017012763.1

PREDICTED: Homo sapiens sarcoglycan epsilon (SGCE), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGCE (8910)
Length:
3642
CDS:
150..1466

Additional Resources:

NCBI RefSeq record:
XM_017012763.1
NBCI Gene record:
SGCE (8910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414575 ACCTGGATGGCTTCGATATAT pLKO_005 353 CDS 100% 15.000 21.000 N SGCE n/a
2 TRCN0000427296 TGAGACTGCAAGGCATAATTT pLKO_005 479 CDS 100% 15.000 21.000 N SGCE n/a
3 TRCN0000056065 GCAGAGACTATTACACGGATT pLKO.1 991 CDS 100% 4.050 3.240 N SGCE n/a
4 TRCN0000056067 GCCTGTAATAACATGTGATAA pLKO.1 821 CDS 100% 13.200 9.240 N SGCE n/a
5 TRCN0000056064 CCTGGCGAGATTAGTAATGAT pLKO.1 291 CDS 100% 5.625 3.938 N SGCE n/a
6 TRCN0000056063 CGTTGCCATATCAAGCAGAAT pLKO.1 532 CDS 100% 4.950 3.465 N SGCE n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 32 5UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 32 5UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 30 5UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 30 5UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 30 5UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07330 pDONR223 100% 85.4% 84.5% None (many diffs) n/a
2 ccsbBroad304_07330 pLX_304 0% 85.4% 84.5% V5 (many diffs) n/a
Download CSV