Transcript: Human XM_017012977.2

PREDICTED: Homo sapiens adaptor related protein complex 3 subunit mu 2 (AP3M2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP3M2 (10947)
Length:
4485
CDS:
1107..2363

Additional Resources:

NCBI RefSeq record:
XM_017012977.2
NBCI Gene record:
AP3M2 (10947)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234487 CTATAGGAAAGACCAACATTT pLKO_005 2643 3UTR 100% 13.200 18.480 N AP3M2 n/a
2 TRCN0000379496 GTTCAGAGCCAGTGATCAAAG pLKO_005 1396 CDS 100% 10.800 15.120 N AP3M2 n/a
3 TRCN0000065291 CCGTTCTGTTTGTGATTACTT pLKO.1 1181 CDS 100% 5.625 7.875 N AP3M2 n/a
4 TRCN0000065288 CCTAAGAAGATATAGAGTGTT pLKO.1 4245 3UTR 100% 4.950 6.930 N AP3M2 n/a
5 TRCN0000065289 CGTCTGGATATGTATGGAGAA pLKO.1 2277 CDS 100% 4.050 5.670 N AP3M2 n/a
6 TRCN0000234485 TACCGAGTCGAACATTCTTAA pLKO_005 1478 CDS 100% 0.000 0.000 N AP3M2 n/a
7 TRCN0000234483 CACCGAGTGGTGGACACATTT pLKO_005 1356 CDS 100% 13.200 9.240 N AP3M2 n/a
8 TRCN0000379828 GATAAATCAGGCTCCACAATT pLKO_005 1680 CDS 100% 13.200 9.240 N AP3M2 n/a
9 TRCN0000234486 TTGAAGAGATTGATGCAATTA pLKO_005 1657 CDS 100% 13.200 9.240 N AP3M2 n/a
10 TRCN0000234484 AGTTGTGGTTTATGAGGTATT pLKO_005 1424 CDS 100% 10.800 7.560 N AP3M2 n/a
11 TRCN0000379436 GGGTGAAATATACCAACAATG pLKO_005 1618 CDS 100% 10.800 7.560 N AP3M2 n/a
12 TRCN0000065292 CCCTCTGTTTGTCATTGAGTT pLKO.1 1331 CDS 100% 4.950 3.465 N AP3M2 n/a
13 TRCN0000065290 GCCAGACCTTACACTTTCCTT pLKO.1 1751 CDS 100% 3.000 2.100 N AP3M2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11574 pDONR223 100% 64.1% 63.7% None (many diffs) n/a
2 ccsbBroad304_11574 pLX_304 0% 64.1% 63.7% V5 (many diffs) n/a
3 TRCN0000475483 CCATGCAACCCGCGGTTATATAAT pLX_317 41.9% 64.1% 63.7% V5 (many diffs) n/a
Download CSV