Transcript: Human XM_017012989.2

PREDICTED: Homo sapiens RNA binding protein, mRNA processing factor (RBPMS), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBPMS (11030)
Length:
1848
CDS:
553..1083

Additional Resources:

NCBI RefSeq record:
XM_017012989.2
NBCI Gene record:
RBPMS (11030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429813 ATCCGCTTCGATCCTGAAATT pLKO_005 802 CDS 100% 13.200 18.480 N RBPMS n/a
2 TRCN0000163579 GCTAAGGCAAACACGAAGATG pLKO.1 847 CDS 100% 4.950 6.930 N RBPMS n/a
3 TRCN0000164592 CCAAGAACAAACTCGTAGGGA pLKO.1 869 CDS 100% 0.750 1.050 N RBPMS n/a
4 TRCN0000123737 CGACTAGAGTTTGCTAAGGCA pLKO.1 835 CDS 100% 0.750 1.050 N Rbpms n/a
5 TRCN0000164568 CGACTAGAGTTTGCTAAGGCA pLKO.1 835 CDS 100% 0.750 1.050 N RBPMS n/a
6 TRCN0000426066 TCAAACCTCGGGAGCTCTATC pLKO_005 656 CDS 100% 10.800 7.560 N RBPMS n/a
7 TRCN0000161776 CAACACTGTACCTCAGTTCAT pLKO.1 915 CDS 100% 4.950 3.465 N RBPMS n/a
8 TRCN0000159157 GTTCTCTTATAAAGCTCACAT pLKO.1 707 CDS 100% 4.950 3.465 N RBPMS n/a
9 TRCN0000413857 AGGAGGTCCGGACCCTATTTG pLKO_005 614 CDS 100% 4.400 3.080 N RBPMS n/a
10 TRCN0000162443 CATCTAAACAGCCTGTAGGTT pLKO.1 725 CDS 100% 3.000 2.100 N RBPMS n/a
11 TRCN0000163703 GCTCACATCTAAACAGCCTGT pLKO.1 720 CDS 100% 2.160 1.512 N RBPMS n/a
12 TRCN0000159592 GCTGCAAAGAATGCTTTGAAT pLKO.1 778 CDS 100% 0.563 0.394 N RBPMS n/a
13 TRCN0000160934 GTTTGCTAAGGCAAACACGAA pLKO.1 843 CDS 100% 0.264 0.185 N RBPMS n/a
14 TRCN0000418152 AGACCATTTAAGGGCTATGAG pLKO_005 685 CDS 100% 4.950 2.970 N RBPMS n/a
15 TRCN0000431659 TATGAGCTCACAGTGCCTGCA pLKO_005 949 CDS 100% 2.160 1.296 N RBPMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02600 pDONR223 100% 80.3% 80.3% None 528_529ins129 n/a
2 ccsbBroad304_02600 pLX_304 0% 80.3% 80.3% V5 528_529ins129 n/a
3 TRCN0000472652 AAGGAAGCGCAAATAACGCCACCT pLX_317 57.7% 80.3% 80.3% V5 528_529ins129 n/a
Download CSV