Transcript: Human XM_017013181.2

PREDICTED: Homo sapiens t-SNARE domain containing 1 (TSNARE1), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSNARE1 (203062)
Length:
1341
CDS:
40..1209

Additional Resources:

NCBI RefSeq record:
XM_017013181.2
NBCI Gene record:
TSNARE1 (203062)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139680 CGAGTATGGAATCCGCCATTT pLKO.1 147 CDS 100% 10.800 15.120 N TSNARE1 n/a
2 TRCN0000139991 GCTAGATGTTGGACCGAGTAT pLKO.1 133 CDS 100% 4.950 6.930 N TSNARE1 n/a
3 TRCN0000139628 CCAACGTCTTCCGAATCAACT pLKO.1 836 CDS 100% 4.950 3.960 N TSNARE1 n/a
4 TRCN0000139589 CAGGAGACCAACAAGACCATT pLKO.1 946 CDS 100% 4.950 3.465 N TSNARE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13397 pDONR223 100% 74.2% 73.9% None (many diffs) n/a
2 TRCN0000480078 GAGCTTGGTGTTCGTCCACGAAGA pLX_317 24% 74.2% 73.9% V5 (many diffs) n/a
3 ccsbBroadEn_05205 pDONR223 100% 74% 74.2% None (many diffs) n/a
4 ccsbBroad304_05205 pLX_304 0% 74% 74.2% V5 (many diffs) n/a
5 TRCN0000465424 AGAGGACCTCTTTCGGCACCTCGG pLX_317 25.7% 74% 74.2% V5 (many diffs) n/a
Download CSV