Construct: ORF TRCN0000465424
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001120.1_s317c1
- Derived from:
- ccsbBroadEn_05205
- DNA Barcode:
- AGAGGACCTCTTTCGGCACCTCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TSNARE1 (203062)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465424
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_145003.5 | 100% | 100% | |
| 2 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001363740.2 | 99.8% | 99.8% | 1129_1131delCAG |
| 3 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001366901.1 | 99.8% | 99.8% | 983_984insGCA |
| 4 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001366904.1 | 95.5% | 93.6% | (many diffs) |
| 5 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_017013179.1 | 95.3% | 93.4% | (many diffs) |
| 6 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516921.1 | 95.1% | 93.2% | (many diffs) |
| 7 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516922.1 | 90.9% | 86.6% | (many diffs) |
| 8 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001366902.1 | 88.7% | 85.9% | (many diffs) |
| 9 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001366903.1 | 88.3% | 85.6% | (many diffs) |
| 10 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_017013176.1 | 76.6% | 76.5% | 1129_1131delCAG;1367_1831del |
| 11 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516919.1 | 74.8% | 71.8% | (many diffs) |
| 12 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_017013181.2 | 74% | 74.2% | (many diffs) |
| 13 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XR_928309.1 | 71.5% | (many diffs) | |
| 14 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_017013175.1 | 69.8% | 66.8% | (many diffs) |
| 15 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516912.2 | 60.3% | 57.7% | (many diffs) |
| 16 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516916.1 | 60.2% | 57.6% | (many diffs) |
| 17 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516917.2 | 60.2% | 57.6% | (many diffs) |
| 18 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516913.2 | 60.1% | 57.5% | (many diffs) |
| 19 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516924.1 | 59.2% | 57.8% | (many diffs) |
| 20 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516915.2 | 59.1% | 56.5% | (many diffs) |
| 21 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XR_928308.1 | 58.6% | (many diffs) | |
| 22 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516914.1 | 58.3% | 55.8% | (many diffs) |
| 23 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516918.1 | 54.1% | 51.5% | (many diffs) |
| 24 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001291931.2 | 50% | 51% | (many diffs) |
| 25 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516920.1 | 32% | 30.8% | (many diffs) |
| 26 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XR_928307.2 | 28.1% | (many diffs) | |
| 27 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516923.2 | 21.3% | 18.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1608
- ORF length:
- 1539
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcatacgga tccatcgccc gtggaggtgg cctggggagc cgtggccctt 121 tcgggggacc ttcgagacaa ggctgtcagc ccctagagtg cgctagatgt tggaccgagt 181 atggaatccg ccatttcccc tgcccgtcgc cagagagcaa gctgcagaac cgctgtgtgg 241 ggaaggacgg ggaaggtgat ctggggccag caggcacgcc tattgtccca agggccagga 301 agcgagggcc tggggttgcc cctgaaggca gccggatgcc ggagcccacc tcatcaccca 361 ccattggccc gaggaaggac tcggctgctg ggccccatgg ccggatggcg gggcccagca 421 ctacccgggc caagaagagg aagcccaact tctgcccgca ggagaccgag gtgctggtgt 481 ccaaggtgag caagcaccac cagctgctgt ttggcacggg gctgctgaag gccgagccca 541 ctcgcaggta ccgcgtgtgg agccgcatcc tgcaggccgt gaatgcgctg ggctactgtc 601 gccgcgacgt tgtggacctg aagcacaagt ggcgggacct acgagccgtc gtgcggcgca 661 agctgggcga cctccggaag gcggcccatg gccccagccc tggttccggc aagccccagg 721 ccctggctct cacgcccgtg gagcaggtgg tggccaagac cttctcttgc caggccctgc 781 cctccgaggg cttcagtctg gagccgccca gagccaccca ggtcgatccg tgcaacctcc 841 aggagctgtt ccaggagatg tcggccaacg tcttccgaat caactccagt gtgacctcct 901 tggagcggag ccttcagtcc ttagggacac cgagtgacac gcaggagctt cgggacagcc 961 tgcacacggc acagcaggag accaacaaga ccattgcagc cagcgccagc tccgtgaagc 1021 agatggccga gctgctgcgc agctcctgcc cgcaggagcg tctgcagcag gagcgtcctc 1081 agctggaccg gctgaaaacc cagctctcag atgccattca gtgctatgga gtggtgcaga 1141 agaaaattgc agaaaagtcc agagcgctgc ttcccatggc gcagaggggc agtaaacaga 1201 gtccccaggc cccgttTGCC GAGCTGGCTG ATGATGAGAA GGTCTTTAAC GGGAGTGACA 1261 ACATGTGGCA GGGCCAGGAG CAGGCGCTGC TCCCGGACAT CACTGAAGAG GACCTGGAGG 1321 CCATCCGGCT GCGGGAGGAG GCCATCCTGC AGATGGAGAG CAACTTGCTG GATGTGAATC 1381 AGATCATCAA GGACTTGGCC TCCATGGTGT CAGAGCAAGG AGAAGCTGTT GATAGTATTG 1441 AAGCCAGCCT TGAGGCTGCG TCCTCGCATG CGGAGGCAGC CCGCCAGCTC CTGGCTGGAG 1501 CCAGCCGGCA CCAACTCCAG AGACACAAGA TCAAGTGCTG CTTCCTATCA GCTGGAGTCA 1561 CTGCCCTGCT TGTCATCATC ATCATCATCG CCACCTCTGT CCGAAAGTTG CCAACTTTCT 1621 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1681 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1741 GTGGAAAGGA CGAAGAGGAC CTCTTTCGGC ACCTCGGACG CGTTAAGTCg acaatcaacc 1801 tctggattac aaaatttgtg aaagatt