Construct: ORF TRCN0000480078
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006839.1_s317c1
- Derived from:
- ccsbBroadEn_13397
- DNA Barcode:
- GAGCTTGGTGTTCGTCCACGAAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TSNARE1 (203062)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480078
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001363740.2 | 100% | 100% | |
| 2 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_145003.5 | 99.8% | 99.8% | 1128_1129insCAG |
| 3 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001366901.1 | 99.6% | 99.6% | 983_984insGCA;1125_1126insCAG |
| 4 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_017013179.1 | 95.5% | 93.6% | (many diffs) |
| 5 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001366904.1 | 95.3% | 93.4% | (many diffs) |
| 6 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516921.1 | 95.3% | 93.4% | (many diffs) |
| 7 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516922.1 | 91.1% | 86.8% | (many diffs) |
| 8 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001366902.1 | 88.5% | 85.7% | (many diffs) |
| 9 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001366903.1 | 88.5% | 85.7% | (many diffs) |
| 10 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_017013176.1 | 76.8% | 76.6% | 1367_1831del |
| 11 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516919.1 | 74.9% | 71.9% | (many diffs) |
| 12 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_017013181.2 | 74.2% | 73.9% | (many diffs) |
| 13 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XR_928309.1 | 71.7% | (many diffs) | |
| 14 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_017013175.1 | 69.9% | 66.9% | (many diffs) |
| 15 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516916.1 | 60.3% | 57.7% | (many diffs) |
| 16 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516917.2 | 60.3% | 57.7% | (many diffs) |
| 17 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516912.2 | 60.2% | 57.6% | (many diffs) |
| 18 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516913.2 | 60.2% | 57.6% | (many diffs) |
| 19 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516915.2 | 59.2% | 56.6% | (many diffs) |
| 20 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516924.1 | 59.1% | 57.7% | (many diffs) |
| 21 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XR_928308.1 | 58.7% | (many diffs) | |
| 22 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516914.1 | 58.4% | 55.9% | (many diffs) |
| 23 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516918.1 | 54.2% | 51.6% | (many diffs) |
| 24 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | NM_001291931.2 | 50.2% | 51.2% | (many diffs) |
| 25 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516920.1 | 32.1% | 30.9% | (many diffs) |
| 26 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XR_928307.2 | 28.2% | (many diffs) | |
| 27 | human | 203062 | TSNARE1 | t-SNARE domain containing 1 | XM_011516923.2 | 21.4% | 18.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1611
- ORF length:
- 1542
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcatacgga tccatcgccc gtggaggtgg cctggggagc cgtggccctt 121 tcgggggacc ttcgagacaa ggctgtcagc ccctagagtg cgctagatgt tggaccgagt 181 atggaatccg ccatttcccc tgcccgtcgc cagagagcaa gctgcagaac cgctgtgtgg 241 ggaaggacgg ggaaggtgat ctggggccag caggcacgcc tattgtccca agggccagga 301 agcgagggcc tggggttgcc cctgaaggca gccggatgcc ggagcccacc tcatcaccca 361 ccattggccc gaggaaggac tcggctgctg ggccccatgg ccggatggcg gggcccagca 421 ctacccgggc caagaagagg aagcccaact tctgcccgca ggagaccgag gtgctggtgt 481 ccaaggtgag caagcaccac cagctgctgt ttggcacggg gctgctgaag gccgagccca 541 ctcgcaggta ccgcgtgtgg agccgcatcc tgcaggccgt gaatgcgctg ggctactgtc 601 gccgcgacgt tgtggacctg aagcacaagt ggcgggacct acgagccgtc gtgcggcgca 661 agctgggcga cctccggaag gcggcccatg gccccagccc tggttccggc aagccccagg 721 ccctggctct cacgcccgtg gagcaggtgg tggccaagac cttctcttgc caggccctgc 781 cctccgaggg cttcagtctg gagccgccca gagccaccca ggtcgatccg tgcaacctcc 841 aggagctgtt ccaggagatg tcggccaacg tcttccgaat caactccagt gtgacctcct 901 tggagcggag ccttcagtcc ttagggacac cgagtgacac gcaggagctt cgggacagcc 961 tgcacacggc acagcaggag accaacaaga ccattgcagc cagcgccagc tccgtgaagc 1021 agatggccga gctgctgcgc agctcctgcc cgcaggagcg tctgcagcag gagcgtcctc 1081 agctggaccg gctgaaaacc cagctctcag atgccattca gtgctatgga gtggtgcaga 1141 agaaaattgc agaaaagtcc agagcgctgc ttcccatggc gcagaggggc agtaaacagc 1201 agagtcccca ggccccgttt gccgagctgg ctgatgatga gaaggTCTTT AACGGGAGTG 1261 ACAACATGTG GCAGGGCCAG GAGCAGGCGC TGCTCCCGGA CATCACTGAA GAGGACCTGG 1321 AGGCCATCCG GCTGCGGGAG GAGGCCATCC TGCAGATGGA GAGCAACTTG CTGGATGTGA 1381 ATCAGATCAT CAAGGACTTG GCCTCCATGG TGTCAGAGCA AGGAGAAGCT GTTGATAGTA 1441 TTGAAGCCAG CCTTGAGGCT GCGTCCTCGC ATGCGGAGGC AGCCCGCCAG CTCCTGGCTG 1501 GAGCCAGCCG GCACCAACTC CAGAGACACA AGATCAAGTG CTGCTTCCTA TCAGCTGGAG 1561 TCACTGCCCT GCTTGTCATC ATCATCATCA TCGCCACCTC TGTCCGAAAG TTGCCAACTT 1621 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1681 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1741 CTTGTGGAAA GGACGAGAGC TTGGTGTTCG TCCACGAAGA ACGCGTTAAG TCgacaatca 1801 acctctggat tacaaaattt gtgaaagatt