Transcript: Human XM_017013304.1

PREDICTED: Homo sapiens ring finger protein 19A, RBR E3 ubiquitin protein ligase (RNF19A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF19A (25897)
Length:
4184
CDS:
336..2690

Additional Resources:

NCBI RefSeq record:
XM_017013304.1
NBCI Gene record:
RNF19A (25897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364316 TCCTGTCGGAATCGCTTTAAT pLKO_005 1448 CDS 100% 15.000 21.000 N RNF19A n/a
2 TRCN0000004805 CCCATGATATTCGCTTGATAT pLKO.1 889 CDS 100% 13.200 18.480 N RNF19A n/a
3 TRCN0000364317 CGTAAATCAAGGGAGCTAAAT pLKO_005 570 CDS 100% 13.200 18.480 N RNF19A n/a
4 TRCN0000004804 GCCGGGTTTCATTATCATAAT pLKO.1 2786 3UTR 100% 13.200 18.480 N RNF19A n/a
5 TRCN0000004806 CGCAAGATTCACAATCGCTAT pLKO.1 1521 CDS 100% 4.050 5.670 N RNF19A n/a
6 TRCN0000004807 GCCATCCAAATTCAGGCACAA pLKO.1 2042 CDS 100% 4.050 5.670 N RNF19A n/a
7 TRCN0000368902 TTGCTATTCCTGCAATGATTA pLKO_005 1477 CDS 100% 13.200 10.560 N RNF19A n/a
8 TRCN0000225992 CCACGATGTGCTGCTTATATA pLKO_005 1239 CDS 100% 15.000 10.500 N Rnf19a n/a
9 TRCN0000368903 GTGGATGGAATTGCAAGTATT pLKO_005 597 CDS 100% 13.200 9.240 N RNF19A n/a
10 TRCN0000368971 TATACGTTCTTCATCCATTAG pLKO_005 1172 CDS 100% 10.800 7.560 N RNF19A n/a
11 TRCN0000004808 CCTGATATAATGACTTGTCAT pLKO.1 768 CDS 100% 4.950 3.465 N RNF19A n/a
12 TRCN0000041117 GCTTGGGAACAGTTAGTGATA pLKO.1 1921 CDS 100% 4.950 3.465 N Rnf19a n/a
13 TRCN0000364315 GTGGATTGCTTACGACAATAT pLKO_005 801 CDS 100% 13.200 7.920 N RNF19A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07960 pDONR223 100% 93.5% 93.4% None 889G>T;1300_1301ins162 n/a
2 ccsbBroad304_07960 pLX_304 0% 93.5% 93.4% V5 889G>T;1300_1301ins162 n/a
3 TRCN0000476594 GTTACCTGTAGACCGCGAGGTCCC pLX_317 11.7% 93.5% 93.4% V5 889G>T;1300_1301ins162 n/a
Download CSV