Transcript: Human XM_017013317.2

PREDICTED: Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGO2 (27161)
Length:
14308
CDS:
74..2422

Additional Resources:

NCBI RefSeq record:
XM_017013317.2
NBCI Gene record:
AGO2 (27161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432648 CTATGAACTCAGGGCTTTAAA pLKO_005 2713 3UTR 100% 15.000 21.000 N AGO2 n/a
2 TRCN0000433340 ATCGAACATGAGACGTCATTG pLKO_005 2518 3UTR 100% 10.800 15.120 N AGO2 n/a
3 TRCN0000007865 CGTCCGTGAATTTGGAATCAT pLKO.1 1021 CDS 100% 5.625 7.875 N AGO2 n/a
4 TRCN0000433524 ACAGATTCCCAAAGGGTAAAG pLKO_005 593 CDS 100% 10.800 7.560 N AGO2 n/a
5 TRCN0000009632 CAAAGGGTAAAGTTTACCAAA pLKO.1 602 CDS 100% 4.950 3.465 N Ago2 n/a
6 TRCN0000007864 CGGCAAGAAGAGATTAGCAAA pLKO.1 965 CDS 100% 4.950 3.465 N AGO2 n/a
7 TRCN0000007867 GCACAGCCAGTAATCGAGTTT pLKO.1 521 CDS 100% 4.950 3.465 N AGO2 n/a
8 TRCN0000011203 CCAGATTTCAAACTTGGATTT pLKO.1 2578 3UTR 100% 10.800 6.480 N AGO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11851 pDONR223 100% 74.6% 74.8% None (many diffs) n/a
2 ccsbBroad304_11851 pLX_304 0% 74.6% 74.8% V5 (many diffs) n/a
3 TRCN0000468477 CTGAAGCTCCACCCAAAAACGCGC pLX_317 14.7% 74.6% 74.8% V5 (many diffs) n/a
4 ccsbBroadEn_11852 pDONR223 100% 48.2% 48.2% None 1_1215del n/a
5 ccsbBroad304_11852 pLX_304 0% 48.2% 48.2% V5 1_1215del n/a
Download CSV