Transcript: Human XM_017013398.2

PREDICTED: Homo sapiens eukaryotic translation initiation factor 3 subunit E (EIF3E), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EIF3E (3646)
Length:
1701
CDS:
33..1391

Additional Resources:

NCBI RefSeq record:
XM_017013398.2
NBCI Gene record:
EIF3E (3646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074828 GCCACAATATCTTAATGCAAT pLKO.1 749 CDS 100% 4.950 6.930 N EIF3E n/a
2 TRCN0000292002 GCCACAATATCTTAATGCAAT pLKO_005 749 CDS 100% 4.950 6.930 N EIF3E n/a
3 TRCN0000074832 GATACCAACATGGTAGACTTT pLKO.1 171 CDS 100% 4.950 3.960 N EIF3E n/a
4 TRCN0000292000 GATACCAACATGGTAGACTTT pLKO_005 171 CDS 100% 4.950 3.960 N EIF3E n/a
5 TRCN0000074830 CCACCAGTGTATCAGCATTAA pLKO.1 1073 CDS 100% 13.200 9.240 N EIF3E n/a
6 TRCN0000074829 CCAGTACGAATGTGGGAATTA pLKO.1 443 CDS 100% 13.200 9.240 N EIF3E n/a
7 TRCN0000292001 CCAGTACGAATGTGGGAATTA pLKO_005 443 CDS 100% 13.200 9.240 N EIF3E n/a
8 TRCN0000074831 CCCTATCAGCAAGTGATTGAA pLKO.1 1230 CDS 100% 5.625 3.938 N EIF3E n/a
9 TRCN0000292003 CCCTATCAGCAAGTGATTGAA pLKO_005 1230 CDS 100% 5.625 3.938 N EIF3E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00878 pDONR223 100% 97.1% 95.6% None (many diffs) n/a
2 ccsbBroad304_00878 pLX_304 0% 97.1% 95.6% V5 (many diffs) n/a
3 TRCN0000468564 GACGTCGATTGTTTACCCAATTCC pLX_317 31.4% 97.1% 95.6% V5 (many diffs) n/a
4 TRCN0000471374 ACACCTTAAGGGTAGTTTTGTATA pLX_317 36.2% 97.1% 95.8% V5 (not translated due to frame shift) (many diffs) n/a
5 ccsbBroadEn_15484 pDONR223 0% 96.2% 95.1% None (many diffs) n/a
6 ccsbBroad304_15484 pLX_304 0% 96.2% 95.1% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_15482 pDONR223 0% 97% 95.6% None (many diffs) n/a
8 ccsbBroad304_15482 pLX_304 0% 97% 95.6% V5 (many diffs) n/a
9 TRCN0000473778 AGGTCCAACCAACTACATCTCCAT pLX_317 44% 96.9% 94.3% V5 (not translated due to frame shift) (many diffs) n/a
10 ccsbBroadEn_15483 pDONR223 0% 86.3% 84.8% None (many diffs) n/a
11 ccsbBroad304_15483 pLX_304 0% 86.3% 84.8% V5 (many diffs) n/a
12 TRCN0000492250 CTGGCTCGGCCATACATTTCTTAA pLX_317 16% 86.3% 84.8% V5 (many diffs) n/a
Download CSV