Transcript: Human XM_017013415.2

PREDICTED: Homo sapiens LYN proto-oncogene, Src family tyrosine kinase (LYN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYN (4067)
Length:
5081
CDS:
3422..4921

Additional Resources:

NCBI RefSeq record:
XM_017013415.2
NBCI Gene record:
LYN (4067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218685 TGTATCAGCGACATGATTAAA pLKO_005 4538 CDS 100% 15.000 12.000 N LYN n/a
2 TRCN0000010106 GCCAAACTCAACACCTTAGAA pLKO.1 4286 CDS 100% 5.625 3.938 N LYN n/a
3 TRCN0000010101 GGAAGAAGCCAACCTCATGAA pLKO.1 4795 CDS 100% 4.950 3.465 N LYN n/a
4 TRCN0000010107 GCTATTACATCTCTCCACGAA pLKO.1 4506 CDS 100% 2.640 1.848 N LYN n/a
5 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 92 5UTR 100% 4.950 2.475 Y C16orf89 n/a
6 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 185 5UTR 100% 4.950 2.475 Y n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1315 5UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1315 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00954 pDONR223 100% 44.8% 40.4% None (many diffs) n/a
2 ccsbBroad304_00954 pLX_304 28.5% 44.8% 40.4% V5 (many diffs) n/a
3 TRCN0000466140 TAAATGCTCCGCACTTCGTAATCC pLX_317 24.9% 44.8% 40.4% V5 (many diffs) n/a
4 ccsbBroadEn_14691 pDONR223 0% 44.8% 40.4% None (many diffs) n/a
5 ccsbBroad304_14691 pLX_304 35.4% 44.8% 40.4% V5 (many diffs) n/a
6 TRCN0000471646 GTCCTACCCTCCAATGTTAAGAAC pLX_317 26.9% 44.8% 40.4% V5 (many diffs) n/a
7 ccsbBroadEn_06546 pDONR223 100% 44.8% 40.4% None (many diffs) n/a
8 ccsbBroad304_06546 pLX_304 35.5% 44.8% 40.4% V5 (many diffs) n/a
9 TRCN0000469344 CTACGAAATGCTTCACGGTCCCTA pLX_317 21.7% 44.8% 40.4% V5 (many diffs) n/a
10 TRCN0000489438 TACAAGTCCACCTCAGCGCGCCTC pLX_317 25% 44.7% 40.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV