Transcript: Human XM_017013642.2

PREDICTED: Homo sapiens phosphoprotein membrane anchor with glycosphingolipid microdomains 1 (PAG1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAG1 (55824)
Length:
10261
CDS:
232..1530

Additional Resources:

NCBI RefSeq record:
XM_017013642.2
NBCI Gene record:
PAG1 (55824)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123273 TGATCTCTATGCTACTGTTAA pLKO.1 1299 CDS 100% 13.200 18.480 N PAG1 n/a
2 TRCN0000123269 CCGCATTATATCACTGTATAT pLKO.1 5036 3UTR 100% 13.200 10.560 N PAG1 n/a
3 TRCN0000427099 GAACGACTACGAGAGCATAAG pLKO_005 1473 CDS 100% 10.800 8.640 N PAG1 n/a
4 TRCN0000123270 CCTGGACAGTTAGTGAATAAA pLKO.1 1198 CDS 100% 15.000 10.500 N PAG1 n/a
5 TRCN0000422537 CTATGTACTCATCAGTAAATA pLKO_005 1175 CDS 100% 15.000 10.500 N PAG1 n/a
6 TRCN0000431907 GATGTTCAGCCGTTCAGTTAC pLKO_005 423 CDS 100% 10.800 7.560 N PAG1 n/a
7 TRCN0000123272 GTAGAGAGTATCCTTGGAAAT pLKO.1 955 CDS 100% 10.800 7.560 N PAG1 n/a
8 TRCN0000434656 TTAAGCTTCTGGACGAGAATG pLKO_005 1016 CDS 100% 10.800 7.560 N PAG1 n/a
9 TRCN0000123271 CCTGTAATGATCTCTATGCTA pLKO.1 1292 CDS 100% 3.000 2.100 N PAG1 n/a
10 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 7721 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 7721 3UTR 100% 4.050 2.025 Y ORAI2 n/a
12 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 7721 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 7750 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7683 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 7757 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
16 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5109 3UTR 100% 4.950 2.475 Y KAAG1 n/a
17 TRCN0000164260 CCAACATGATGAAACCCTGTA pLKO.1 7756 3UTR 100% 4.050 2.025 Y SWSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.