Transcript: Human XM_017014102.2

PREDICTED: Homo sapiens phytanoyl-CoA 2-hydroxylase interacting protein (PHYHIP), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHYHIP (9796)
Length:
3476
CDS:
1237..1830

Additional Resources:

NCBI RefSeq record:
XM_017014102.2
NBCI Gene record:
PHYHIP (9796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438426 ACGGTGGTCCTCTTGGTAAGT pLKO_005 1985 3UTR 100% 4.950 6.930 N PHYHIP n/a
2 TRCN0000167466 GATCCCTTCCTTCTATAAATA pLKO.1 2345 3UTR 100% 15.000 10.500 N PHYHIP n/a
3 TRCN0000250494 CCAGCACCAACCTCTACTTTG pLKO_005 1484 CDS 100% 10.800 7.560 N Phyhip n/a
4 TRCN0000426405 ACCTCTACTTTGCGGACTTCT pLKO_005 1493 CDS 100% 4.950 3.465 N PHYHIP n/a
5 TRCN0000414163 AGCCTTACCTGAAGGACAACA pLKO_005 1319 CDS 100% 4.950 3.465 N PHYHIP n/a
6 TRCN0000168819 CAACCATCACAAGGAGTACTT pLKO.1 1263 CDS 100% 4.950 3.465 N PHYHIP n/a
7 TRCN0000173019 CCTGGACATTGCTTGCAACAA pLKO.1 1605 CDS 100% 4.950 3.465 N PHYHIP n/a
8 TRCN0000444723 TCAGCTGCAACACGGAGTTCA pLKO_005 1388 CDS 100% 4.950 3.465 N PHYHIP n/a
9 TRCN0000172426 CCTGGAGATCATCTACACTGA pLKO.1 1686 CDS 100% 2.640 1.848 N PHYHIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07488 pDONR223 100% 59.2% 58.7% None (many diffs) n/a
2 ccsbBroad304_07488 pLX_304 0% 59.2% 58.7% V5 (many diffs) n/a
3 TRCN0000469780 GCCTTCAGACTATTATAACTATCC pLX_317 32.2% 59.2% 58.7% V5 (many diffs) n/a
Download CSV