Transcript: Human XM_017014275.1

PREDICTED: Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRAT (1384)
Length:
2586
CDS:
100..1983

Additional Resources:

NCBI RefSeq record:
XM_017014275.1
NBCI Gene record:
CRAT (1384)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035495 GTCATCGAGTACACGAAGAAA pLKO.1 1174 CDS 100% 5.625 7.875 N CRAT n/a
2 TRCN0000421538 GATCAAGAGCGACATCGAGAA pLKO_005 1266 CDS 100% 4.050 5.670 N CRAT n/a
3 TRCN0000437746 GTGTGCCTAGATGCAACCATG pLKO_005 958 CDS 100% 4.050 5.670 N CRAT n/a
4 TRCN0000419400 CATTGAGGGTGTGTTGGATTT pLKO_005 528 CDS 100% 10.800 8.640 N CRAT n/a
5 TRCN0000035498 CGTGATGGTGTTCCACCATTT pLKO.1 1332 CDS 100% 1.080 0.864 N CRAT n/a
6 TRCN0000035497 CAAGACAGACTGTGTCATGTT pLKO.1 1776 CDS 100% 4.950 3.465 N CRAT n/a
7 TRCN0000035496 CAAGGCATACAACACCCTCAT pLKO.1 882 CDS 100% 4.050 2.835 N CRAT n/a
8 TRCN0000437912 CAAATCTACTGAGCCACGGAC pLKO_005 2099 3UTR 100% 2.160 1.512 N CRAT n/a
9 TRCN0000035494 CGTGGTACACAACTACCAGTT pLKO.1 714 CDS 100% 0.405 0.284 N CRAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10748 pDONR223 100% 85.3% 85.3% None (many diffs) n/a
2 ccsbBroad304_10748 pLX_304 0% 85.3% 85.3% V5 (many diffs) n/a
3 TRCN0000466858 TACTGGATCAGTCGGGGGAAGCAG pLX_317 16.1% 85.3% 85.3% V5 (many diffs) n/a
Download CSV