Transcript: Human XM_017014543.2

PREDICTED: Homo sapiens peptidase, mitochondrial processing alpha subunit (PMPCA), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PMPCA (23203)
Length:
2081
CDS:
553..1584

Additional Resources:

NCBI RefSeq record:
XM_017014543.2
NBCI Gene record:
PMPCA (23203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051474 GCGAAATACCTTAGTGGAATT pLKO.1 282 5UTR 100% 0.000 0.000 N PMPCA n/a
2 TRCN0000290302 GCGAAATACCTTAGTGGAATT pLKO_005 282 5UTR 100% 0.000 0.000 N PMPCA n/a
3 TRCN0000051475 GCTGACATCAATGCTCATGAT pLKO.1 1296 CDS 100% 4.950 3.465 N PMPCA n/a
4 TRCN0000290372 GCTGACATCAATGCTCATGAT pLKO_005 1296 CDS 100% 4.950 3.465 N PMPCA n/a
5 TRCN0000051476 GCTACAGTTGATGGACAGGAA pLKO.1 147 5UTR 100% 2.640 1.848 N PMPCA n/a
6 TRCN0000290373 GCTACAGTTGATGGACAGGAA pLKO_005 147 5UTR 100% 2.640 1.848 N PMPCA n/a
7 TRCN0000051477 CGCAACGTGAAGCCGGAAGAT pLKO.1 1414 CDS 100% 1.650 1.155 N PMPCA n/a
8 TRCN0000290375 CGCAACGTGAAGCCGGAAGAT pLKO_005 1414 CDS 100% 1.650 1.155 N PMPCA n/a
9 TRCN0000051473 GCTCGATTTGACAGCAAAGAT pLKO.1 339 5UTR 100% 5.625 3.375 N PMPCA n/a
10 TRCN0000290304 GCTCGATTTGACAGCAAAGAT pLKO_005 339 5UTR 100% 5.625 3.375 N PMPCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07853 pDONR223 100% 65.2% 65.3% None 0_1ins546;156C>T n/a
2 ccsbBroad304_07853 pLX_304 0% 65.2% 65.3% V5 0_1ins546;156C>T n/a
3 TRCN0000477523 TTAAAATCGCCAGCACTACGCCTT pLX_317 22.7% 65.2% 65.3% V5 0_1ins546;156C>T n/a
4 ccsbBroadEn_15008 pDONR223 54.9% 64.9% 2.5% None 0_1ins547;200_202delACCinsGTT;204_205delCA n/a
5 ccsbBroad304_15008 pLX_304 0% 64.9% 2.5% V5 (not translated due to prior stop codon) 0_1ins547;200_202delACCinsGTT;204_205delCA n/a
6 TRCN0000480244 CATGTGCGTCGTAGAGGGTCGTAC pLX_317 22.7% 64.9% 2.5% V5 (not translated due to prior stop codon) 0_1ins547;200_202delACCinsGTT;204_205delCA n/a
Download CSV