Transcript: Human XM_017014795.1

PREDICTED: Homo sapiens EGF like domain multiple 7 (EGFL7), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EGFL7 (51162)
Length:
2211
CDS:
1070..1819

Additional Resources:

NCBI RefSeq record:
XM_017014795.1
NBCI Gene record:
EGFL7 (51162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372058 TGCAAGAAAGACTCGTGACTG pLKO_005 1802 CDS 100% 4.050 5.670 N EGFL7 n/a
2 TRCN0000053661 AGGAGTGGACAGTGCAATGAA pLKO.1 1567 CDS 100% 5.625 3.938 N EGFL7 n/a
3 TRCN0000053658 GCCAGTCAGATGTGGATGAAT pLKO.1 1398 CDS 100% 5.625 3.938 N EGFL7 n/a
4 TRCN0000053662 CGAGCAGATTTCCTTCCTGGA pLKO.1 1759 CDS 100% 2.160 1.512 N EGFL7 n/a
5 TRCN0000053660 CGGTACACTCTGTGTGCCCAA pLKO.1 1513 CDS 100% 0.720 0.504 N EGFL7 n/a
6 TRCN0000372114 CAGTTACTGGTGCCAGTGTTG pLKO_005 1468 CDS 100% 4.050 2.430 N EGFL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08236 pDONR223 100% 77.3% 65.3% None (many diffs) n/a
2 ccsbBroad304_08236 pLX_304 0% 77.3% 65.3% V5 (many diffs) n/a
3 TRCN0000474432 AAATTCCAGCTATTAGCTTCGAGT pLX_317 48.7% 77.3% 65.3% V5 (many diffs) n/a
Download CSV