Transcript: Human XM_017014898.1

PREDICTED: Homo sapiens spermatid perinuclear RNA binding protein (STRBP), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STRBP (55342)
Length:
3257
CDS:
258..2204

Additional Resources:

NCBI RefSeq record:
XM_017014898.1
NBCI Gene record:
STRBP (55342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014898.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017719 CGCTTTGTAATGGAGGTAGAA pLKO.1 1875 CDS 100% 4.950 6.930 N STRBP n/a
2 TRCN0000017718 CGCCATGTTATGGTGAAACAT pLKO.1 291 CDS 100% 0.563 0.788 N STRBP n/a
3 TRCN0000425305 TGAAAGATCCTCCGGACTTAT pLKO_005 805 CDS 100% 13.200 10.560 N STRBP n/a
4 TRCN0000017721 CGTCTCTTCGACATGCCAAAT pLKO.1 856 CDS 100% 10.800 8.640 N STRBP n/a
5 TRCN0000418661 GATCAAGGTGGTCGGACATTG pLKO_005 483 CDS 100% 10.800 8.640 N STRBP n/a
6 TRCN0000086389 GCTTGCTGATTAAAGATGATA pLKO.1 538 CDS 100% 5.625 3.938 N Strbp n/a
7 TRCN0000315912 GCTTGCTGATTAAAGATGATA pLKO_005 538 CDS 100% 5.625 3.938 N Strbp n/a
8 TRCN0000086388 GCTGAGATATAGTGACTGTAA pLKO.1 2291 3UTR 100% 4.950 3.465 N Strbp n/a
9 TRCN0000315988 GCTGAGATATAGTGACTGTAA pLKO_005 2291 3UTR 100% 4.950 3.465 N Strbp n/a
10 TRCN0000017720 CCTTCCATCTAGTAAGCCTTT pLKO.1 1247 CDS 100% 4.050 2.835 N STRBP n/a
11 TRCN0000086390 CCTATTCAGATTCAGAAACTA pLKO.1 633 CDS 100% 5.625 3.938 N Strbp n/a
12 TRCN0000315986 CCTATTCAGATTCAGAAACTA pLKO_005 633 CDS 100% 5.625 3.938 N Strbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014898.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08525 pDONR223 100% 96.3% 96.4% None 960C>T;1944_1945ins72 n/a
2 ccsbBroad304_08525 pLX_304 0% 96.3% 96.4% V5 960C>T;1944_1945ins72 n/a
3 TRCN0000473208 ACGCAAGCATAACAGAGCTCCCTT pLX_317 20.2% 96.3% 96.4% V5 960C>T;1944_1945ins72 n/a
Download CSV