Transcript: Human XM_017015217.2

PREDICTED: Homo sapiens major facilitator superfamily domain containing 14B (MFSD14B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFSD14B (84641)
Length:
3100
CDS:
267..1592

Additional Resources:

NCBI RefSeq record:
XM_017015217.2
NBCI Gene record:
MFSD14B (84641)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015217.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115896 GCGTCGTTGAAGAAAGTTGGA pLKO.1 798 CDS 100% 2.640 3.696 N MFSD14B n/a
2 TRCN0000292072 GCGTCGTTGAAGAAAGTTGGA pLKO_005 798 CDS 100% 2.640 3.696 N MFSD14B n/a
3 TRCN0000115894 CCCGAAATTGAATTCTAACAA pLKO.1 1307 CDS 100% 0.000 0.000 N MFSD14B n/a
4 TRCN0000292128 CCCGAAATTGAATTCTAACAA pLKO_005 1307 CDS 100% 0.000 0.000 N MFSD14B n/a
5 TRCN0000115892 GCTGCTTCTAAGAAAGTTATT pLKO.1 2382 3UTR 100% 13.200 9.240 N MFSD14B n/a
6 TRCN0000292071 GCTGCTTCTAAGAAAGTTATT pLKO_005 2382 3UTR 100% 13.200 9.240 N MFSD14B n/a
7 TRCN0000115895 GTCGTTGAAGAAAGTTGGAAA pLKO.1 800 CDS 100% 4.950 3.465 N MFSD14B n/a
8 TRCN0000115893 GCAGCATTCATAGCTATGGTA pLKO.1 942 CDS 100% 3.000 2.100 N MFSD14B n/a
9 TRCN0000307954 GCAGCATTCATAGCTATGGTA pLKO_005 942 CDS 100% 3.000 2.100 N MFSD14B n/a
10 TRCN0000155509 CCTCGGCACTGTATTCTTTAC pLKO.1 410 CDS 100% 10.800 5.400 Y MFSD14C n/a
11 TRCN0000151902 CAACACACATTCCTCATGAAT pLKO.1 297 CDS 100% 5.625 2.813 Y MFSD14C n/a
12 TRCN0000154350 CAATCCCACTGATGAGGATCA pLKO.1 439 CDS 100% 4.050 2.025 Y MFSD14C n/a
13 TRCN0000152086 CACTGTATTCTTTACCTGCTT pLKO.1 416 CDS 100% 2.640 1.320 Y MFSD14C n/a
14 TRCN0000153160 GCACTGTATTCTTTACCTGCT pLKO.1 415 CDS 100% 2.160 1.080 Y MFSD14C n/a
15 TRCN0000151493 CTCATGAATGGTCTCATTCAA pLKO.1 309 CDS 100% 0.563 0.281 Y MFSD14C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015217.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10264 pDONR223 100% 18.4% 15.3% None (many diffs) n/a
2 ccsbBroad304_10264 pLX_304 0% 18.4% 15.3% V5 (many diffs) n/a
3 TRCN0000470777 GTACTCACCACGTTGCAGTTCAGG pLX_317 100% 18.4% 15.3% V5 (many diffs) n/a
Download CSV