Transcript: Human XM_017015647.1

PREDICTED: Homo sapiens zinc finger FYVE-type containing 27 (ZFYVE27), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFYVE27 (118813)
Length:
3025
CDS:
200..1429

Additional Resources:

NCBI RefSeq record:
XM_017015647.1
NBCI Gene record:
ZFYVE27 (118813)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136870 CCCTGCCTTTCTCAAGTATTT pLKO.1 2567 3UTR 100% 13.200 9.240 N ZFYVE27 n/a
2 TRCN0000137025 CAACGTCTTGTTCCTCACTTT pLKO.1 439 CDS 100% 4.950 3.465 N ZFYVE27 n/a
3 TRCN0000136788 CAACTTGGTTCTCTCCTACAA pLKO.1 313 CDS 100% 4.950 3.465 N ZFYVE27 n/a
4 TRCN0000134203 CCAACAGTTTCATGTTCACTA pLKO.1 2471 3UTR 100% 4.950 3.465 N ZFYVE27 n/a
5 TRCN0000137404 GCTTCTAGAAACAGGGTTGAA pLKO.1 1998 3UTR 100% 4.950 3.465 N ZFYVE27 n/a
6 TRCN0000137843 GCAGATGCCTTTGTGTTCCTT pLKO.1 400 CDS 100% 3.000 2.100 N ZFYVE27 n/a
7 TRCN0000137819 GAAACAGCTTCTGCTCTCGAT pLKO.1 1302 CDS 100% 2.640 1.848 N ZFYVE27 n/a
8 TRCN0000138667 GTGTAACCAGACCTTGAGCAA pLKO.1 1405 CDS 100% 2.640 1.848 N ZFYVE27 n/a
9 TRCN0000138786 GAAGAGCTTCTTGATCCAGCT pLKO.1 646 CDS 100% 2.160 1.512 N ZFYVE27 n/a
10 TRCN0000138680 GAAGTATCATAGCGTGAGGCA pLKO.1 574 CDS 100% 0.660 0.462 N ZFYVE27 n/a
11 TRCN0000138586 CTTCCGAGTTGTGTCTGAGTA pLKO.1 856 CDS 100% 4.950 2.970 N ZFYVE27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13072 pDONR223 100% 80.6% 80.5% None (many diffs) n/a
2 ccsbBroad304_13072 pLX_304 0% 80.6% 80.5% V5 (many diffs) n/a
3 TRCN0000473164 ACTATGTATCCCCCATGCCTCGCG pLX_317 41.5% 80.6% 80.5% V5 (many diffs) n/a
Download CSV