Transcript: Human XM_017016263.1

PREDICTED: Homo sapiens DENN domain containing 10 (DENND10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND10 (404636)
Length:
2913
CDS:
534..1583

Additional Resources:

NCBI RefSeq record:
XM_017016263.1
NBCI Gene record:
DENND10 (404636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134078 GCAACTTCGATGAAAGTAGTT pLKO.1 2438 3UTR 100% 4.950 3.465 N DENND10 n/a
2 TRCN0000137866 GCTTCCAGCAACTTCGATGAA pLKO.1 2431 3UTR 100% 4.950 3.465 N DENND10 n/a
3 TRCN0000137640 GAGAAATCAGAGAGCCACGTT pLKO.1 1380 CDS 100% 2.640 1.584 N DENND10 n/a
4 TRCN0000134359 GCACATCACAACAAATGTGAA pLKO.1 1871 3UTR 100% 0.495 0.297 N DENND10 n/a
5 TRCN0000121908 CGAAGTGCTATAACTACTTTA pLKO.1 1804 3UTR 100% 13.200 6.600 Y DENND10P1 n/a
6 TRCN0000138293 CTTCCACGACAGCCACATTAA pLKO.1 607 CDS 100% 13.200 6.600 Y DENND10 n/a
7 TRCN0000142359 GTTCTGTGGGTGTGGTGTTAT pLKO.1 585 CDS 100% 13.200 6.600 Y DENND10P1 n/a
8 TRCN0000136571 CCTTAATTTGGAGGCGCTAAA pLKO.1 1487 CDS 100% 10.800 5.400 Y DENND10 n/a
9 TRCN0000215338 CTCCATCAAAGACATTGTATC pLKO.1 980 CDS 100% 10.800 5.400 Y Fam45a n/a
10 TRCN0000137434 GCAGTTGCACTTTCTCGTAAA pLKO.1 2085 3UTR 100% 10.800 5.400 Y DENND10 n/a
11 TRCN0000136868 CCAGACCTCTATGATGTGTTT pLKO.1 1245 CDS 100% 4.950 2.475 Y DENND10 n/a
12 TRCN0000143696 GACTGATAGAAAGCCCTCTTT pLKO.1 1609 3UTR 100% 4.950 2.475 Y DENND10P1 n/a
13 TRCN0000141962 GCAATGGGCAAACTGCACAAA pLKO.1 1320 CDS 100% 4.950 2.475 Y DENND10P1 n/a
14 TRCN0000137239 GCAGAGAGTGAGATTACCATT pLKO.1 1275 CDS 100% 4.950 2.475 Y DENND10 n/a
15 TRCN0000141718 GCTGGCTCCATCAAAGACATT pLKO.1 975 CDS 100% 4.950 2.475 Y DENND10P1 n/a
16 TRCN0000142920 CACAAAGAAATGGGTCAGCTA pLKO.1 1335 CDS 100% 2.640 1.320 Y DENND10P1 n/a
17 TRCN0000142335 CGCTGGATTTGTAGACTTGGA pLKO.1 1211 CDS 100% 2.640 1.320 Y DENND10P1 n/a
18 TRCN0000193953 GTGTTTGTGAATCTGGCAGAT pLKO.1 1260 CDS 100% 4.050 2.025 Y Fam45a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05655 pDONR223 100% 94.7% 94.7% None (many diffs) n/a
2 ccsbBroad304_05655 pLX_304 0% 94.7% 94.7% V5 (many diffs) n/a
3 TRCN0000471589 AGATGCAGCGCCACAGGGAATCAA pLX_317 33.1% 94.7% 94.7% V5 (many diffs) n/a
4 ccsbBroadEn_08599 pDONR223 100% 94.4% 93.8% None (many diffs) n/a
5 ccsbBroad304_08599 pLX_304 0% 94.4% 93.8% V5 (many diffs) n/a
6 TRCN0000475565 CGACCGCATCACTAATATAACCAG pLX_317 27.7% 94.4% 93.8% V5 (many diffs) n/a
Download CSV