Transcript: Human XM_017016337.1

PREDICTED: Homo sapiens pantothenate kinase 1 (PANK1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PANK1 (53354)
Length:
4149
CDS:
1655..2731

Additional Resources:

NCBI RefSeq record:
XM_017016337.1
NBCI Gene record:
PANK1 (53354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197214 GCGCGTTGAATGAGAACATAG pLKO.1 2532 CDS 100% 10.800 15.120 N PANK1 n/a
2 TRCN0000197255 GCTATGCACAGGTTCATTCAG pLKO.1 1880 CDS 100% 4.950 6.930 N PANK1 n/a
3 TRCN0000199686 GCCTGCTTTATGTCGACTCTG pLKO.1 2043 CDS 100% 4.050 5.670 N PANK1 n/a
4 TRCN0000037561 GCCTTGATAACCCATACCCTA pLKO.1 2142 CDS 100% 2.640 3.696 N PANK1 n/a
5 TRCN0000194665 CCTATGTTGCTGGTTAACATG pLKO.1 2159 CDS 100% 0.495 0.693 N PANK1 n/a
6 TRCN0000037563 GCTGGCATATGCCATGGATTT pLKO.1 2608 CDS 100% 0.000 0.000 N PANK1 n/a
7 TRCN0000037560 CGCTGGTTAAATTGGTGTATT pLKO.1 1671 CDS 100% 13.200 10.560 N PANK1 n/a
8 TRCN0000196696 GTTTGTCCTATCGCTTATAAA pLKO.1 3493 3UTR 100% 15.000 10.500 N PANK1 n/a
9 TRCN0000361881 TTTGGAACATGAGGGTTATTT pLKO_005 2659 CDS 100% 15.000 10.500 N Pank1 n/a
10 TRCN0000424569 AGTAATTACTCTAGGAGATTT pLKO_005 3110 3UTR 100% 13.200 9.240 N PANK1 n/a
11 TRCN0000428890 TGAAGAGCATCCGGAAGTATT pLKO_005 1743 CDS 100% 13.200 9.240 N PANK1 n/a
12 TRCN0000037559 CCCTACCTGTAACCTTTCTTT pLKO.1 3324 3UTR 100% 5.625 3.938 N PANK1 n/a
13 TRCN0000037562 CCGAAGGATATTACAGCCGAA pLKO.1 1697 CDS 100% 2.160 1.512 N PANK1 n/a
14 TRCN0000195062 CGGAAGTATTTGACTTCTAAT pLKO.1 1754 CDS 100% 1.320 0.792 N PANK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12021 pDONR223 100% 38.2% 38.2% None 1_663del n/a
2 ccsbBroad304_12021 pLX_304 0% 38.2% 38.2% V5 1_663del n/a
3 TRCN0000475014 CCGGATTTTAACCCTTCACTGAGC pLX_317 100% 38.2% 38.2% V5 1_663del n/a
4 TRCN0000487959 CGACCGATTATTCACTTTGCAAAA pLX_317 72% 38.2% 38.2% V5 (not translated due to prior stop codon) 1_663del n/a
Download CSV