Transcript: Human XM_017016782.1

PREDICTED: Homo sapiens phytanoyl-CoA 2-hydroxylase interacting protein like (PHYHIPL), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHYHIPL (84457)
Length:
3191
CDS:
286..1278

Additional Resources:

NCBI RefSeq record:
XM_017016782.1
NBCI Gene record:
PHYHIPL (84457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417350 GGATCGCATTACACACTATTT pLKO_005 378 CDS 100% 13.200 18.480 N PHYHIPL n/a
2 TRCN0000134665 GTAATATCAGTGTTGGACGTT pLKO.1 1256 CDS 100% 2.640 3.696 N PHYHIPL n/a
3 TRCN0000257850 TAATTGCAGCATGAGTTAAAT pLKO_005 1693 3UTR 100% 15.000 10.500 N Phyhipl n/a
4 TRCN0000249026 GCAGCGCCTTCCTCAACTAAA pLKO_005 1038 CDS 100% 13.200 9.240 N Phyhipl n/a
5 TRCN0000430053 TATGTACACTGCTTATCATTA pLKO_005 966 CDS 100% 13.200 9.240 N PHYHIPL n/a
6 TRCN0000415158 TGATGAAATACCCTAAGTTAA pLKO_005 1479 3UTR 100% 13.200 9.240 N PHYHIPL n/a
7 TRCN0000134787 CCCATCCAAACTATAAGAGAA pLKO.1 2119 3UTR 100% 4.950 3.465 N PHYHIPL n/a
8 TRCN0000134499 GCCTCTGAAATAAGTCTGTTT pLKO.1 2078 3UTR 100% 4.950 3.465 N PHYHIPL n/a
9 TRCN0000136535 CCATCTGTCAAGGATAACAGT pLKO.1 769 CDS 100% 3.000 2.100 N PHYHIPL n/a
10 TRCN0000134051 CCCAAGAACTGAATATACAGT pLKO.1 522 CDS 100% 3.000 2.100 N PHYHIPL n/a
11 TRCN0000137365 GAGAACATCATGGGAATGCTA pLKO.1 743 CDS 100% 3.000 2.100 N PHYHIPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12821 pDONR223 100% 99.8% 99.6% None 886G>C n/a
2 ccsbBroad304_12821 pLX_304 0% 99.8% 99.6% V5 886G>C n/a
3 TRCN0000467815 AGGGAGCTCCCAACTCAGTTTGGA pLX_317 35% 99.8% 99.6% V5 886G>C n/a
Download CSV