Transcript: Human XM_017016962.1

PREDICTED: Homo sapiens ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENTPD1 (953)
Length:
1054
CDS:
55..942

Additional Resources:

NCBI RefSeq record:
XM_017016962.1
NBCI Gene record:
ENTPD1 (953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050291 CCCAGATAATGCTCTGCAATT pLKO.1 807 CDS 100% 10.800 15.120 N ENTPD1 n/a
2 TRCN0000257193 GCACCAAGAGACACCCGTTTA pLKO_005 471 CDS 100% 10.800 15.120 N ENTPD1 n/a
3 TRCN0000230633 GCCTATGGCTGGATTACTATC pLKO_005 637 CDS 100% 10.800 7.560 N ENTPD1 n/a
4 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 986 3UTR 100% 4.050 2.025 Y P3H4 n/a
5 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 986 3UTR 100% 4.050 2.025 Y ORAI2 n/a
6 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 986 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488654 TTACAATCACTTAGGGAGTACATA pLX_317 23.7% 47.7% 42.1% V5 (many diffs) n/a
2 TRCN0000488171 TCATCTCCCGTACCTCATGACTTG pLX_317 20.5% 47.6% 42.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV