Transcript: Human XM_017016963.1

PREDICTED: Homo sapiens ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENTPD1 (953)
Length:
1034
CDS:
56..922

Additional Resources:

NCBI RefSeq record:
XM_017016963.1
NBCI Gene record:
ENTPD1 (953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050291 CCCAGATAATGCTCTGCAATT pLKO.1 787 CDS 100% 10.800 15.120 N ENTPD1 n/a
2 TRCN0000257193 GCACCAAGAGACACCCGTTTA pLKO_005 451 CDS 100% 10.800 15.120 N ENTPD1 n/a
3 TRCN0000230633 GCCTATGGCTGGATTACTATC pLKO_005 617 CDS 100% 10.800 7.560 N ENTPD1 n/a
4 TRCN0000358681 TTGGCTTCTCCTCTATCATAG pLKO_005 153 CDS 100% 10.800 7.560 N ENTPD1 n/a
5 TRCN0000050292 TCCTCTATCATAGCTGTGATA pLKO.1 161 CDS 100% 0.495 0.347 N ENTPD1 n/a
6 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 966 3UTR 100% 4.050 2.025 Y P3H4 n/a
7 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 966 3UTR 100% 4.050 2.025 Y ORAI2 n/a
8 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 966 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488654 TTACAATCACTTAGGGAGTACATA pLX_317 23.7% 52.4% 51.1% V5 (many diffs) n/a
2 TRCN0000488171 TCATCTCCCGTACCTCATGACTTG pLX_317 20.5% 52.3% 51.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV