Transcript: Human XM_017017048.1

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily E regulatory subunit 3 (KCNE3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNE3 (10008)
Length:
3025
CDS:
514..825

Additional Resources:

NCBI RefSeq record:
XM_017017048.1
NBCI Gene record:
KCNE3 (10008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045060 GAACCGTGTGTCTATGATCTA pLKO.1 804 CDS 100% 4.950 6.930 N KCNE3 n/a
2 TRCN0000045061 CCCGCAAAGTGGACAAGCGTA pLKO.1 758 CDS 100% 0.880 1.232 N KCNE3 n/a
3 TRCN0000045058 CCGTGATGACAACTCCTACAT pLKO.1 669 CDS 100% 4.950 3.960 N KCNE3 n/a
4 TRCN0000414724 CACTCTTCACAGCAATTTGCT pLKO_005 582 CDS 100% 3.000 2.400 N KCNE3 n/a
5 TRCN0000421549 AGCCCATGAACAAACATATAA pLKO_005 1053 3UTR 100% 15.000 10.500 N KCNE3 n/a
6 TRCN0000045059 GCCGTGCTGAAGGCTCTAAAT pLKO.1 559 CDS 100% 13.200 9.240 N KCNE3 n/a
7 TRCN0000429607 CATGTTTCTATTTGCTGTAAC pLKO_005 705 CDS 100% 10.800 7.560 N KCNE3 n/a
8 TRCN0000045062 CTCCTACATGTACATTCTCTT pLKO.1 681 CDS 100% 4.950 3.465 N KCNE3 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2001 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2001 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02288 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02288 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473873 GTTAACAATACAGTTGTCTAATCA pLX_317 100% 100% 100% V5 n/a
Download CSV