Transcript: Human XM_017017415.2

PREDICTED: Homo sapiens family with sequence similarity 168 member A (FAM168A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM168A (23201)
Length:
6874
CDS:
19..600

Additional Resources:

NCBI RefSeq record:
XM_017017415.2
NBCI Gene record:
FAM168A (23201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264243 GAGTATGTAGGCGTGTTATTA pLKO_005 1163 3UTR 100% 15.000 21.000 N FAM168A n/a
2 TRCN0000192682 GTATCCAATCAGAAGTGCCTA pLKO.1 267 CDS 100% 2.640 3.696 N Fam168a n/a
3 TRCN0000264247 CTGTCTCCATGCCAACATATA pLKO_005 533 CDS 100% 13.200 10.560 N FAM168A n/a
4 TRCN0000264246 CCCACCAATAGTCCCAGTTAT pLKO_005 142 CDS 100% 13.200 9.240 N FAM168A n/a
5 TRCN0000264244 CCTATCAGACGGCCATGTATC pLKO_005 251 CDS 100% 10.800 7.560 N FAM168A n/a
6 TRCN0000190202 CCTAAGAACATGGCCTACACT pLKO.1 67 CDS 100% 3.000 2.100 N Fam168a n/a
7 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 1813 3UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02736 pDONR223 100% 82.1% 81.7% None 151_152ins126 n/a
2 ccsbBroad304_02736 pLX_304 0% 82.1% 81.7% V5 151_152ins126 n/a
3 TRCN0000469372 TCTCTTAAGACTTCGACGTGGACC pLX_317 53.7% 82.1% 81.7% V5 151_152ins126 n/a
Download CSV