Transcript: Human XM_017017620.1

PREDICTED: Homo sapiens adipogenesis associated Mth938 domain containing (AAMDC), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AAMDC (28971)
Length:
1207
CDS:
112..612

Additional Resources:

NCBI RefSeq record:
XM_017017620.1
NBCI Gene record:
AAMDC (28971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263812 AGGCTCTAATACAACCTATAA pLKO_005 219 CDS 100% 13.200 18.480 N AAMDC n/a
2 TRCN0000263814 GTGTACAGACTCTTGTGATTG pLKO_005 350 CDS 100% 10.800 7.560 N AAMDC n/a
3 TRCN0000263813 CAGATGTGAAGGAAGTTGTTG pLKO_005 323 CDS 100% 4.950 3.465 N AAMDC n/a
4 TRCN0000168735 GAGAAACAGGAACTGAGCATT pLKO.1 284 CDS 100% 4.950 3.465 N AAMDC n/a
5 TRCN0000263815 AGTCGGACTTGGGATTGGAGA pLKO_005 265 CDS 100% 2.640 1.848 N AAMDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03049 pDONR223 100% 60.8% 50.5% None (many diffs) n/a
2 ccsbBroadEn_11889 pDONR223 100% 50% 47% None (many diffs) n/a
3 ccsbBroad304_11889 pLX_304 0% 50% 47% V5 (many diffs) n/a
4 TRCN0000465280 CAGTTCAGCTACACACAGTAATTT pLX_317 100% 50% 47% V5 (many diffs) n/a
Download CSV