Transcript: Human XM_017017670.2

PREDICTED: Homo sapiens immunoglobulin mu DNA binding protein 2 (IGHMBP2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGHMBP2 (3508)
Length:
4673
CDS:
1833..3803

Additional Resources:

NCBI RefSeq record:
XM_017017670.2
NBCI Gene record:
IGHMBP2 (3508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019160 CCTTTGAGTATCTTGACGATA pLKO.1 2737 CDS 100% 4.950 6.930 N IGHMBP2 n/a
2 TRCN0000364795 GAAGACCCTGGTGGAGTATTT pLKO_005 2690 CDS 100% 13.200 9.240 N IGHMBP2 n/a
3 TRCN0000369612 GGTTCCAGTCCCTGGAGAATA pLKO_005 4103 3UTR 100% 13.200 9.240 N IGHMBP2 n/a
4 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 127 5UTR 100% 10.800 5.400 Y SMIM11A n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 748 5UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 748 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06433 pDONR223 100% 65.9% 65.9% None 0_1ins1011;1000A>G;1305C>T n/a
2 ccsbBroad304_06433 pLX_304 0% 65.9% 65.9% V5 0_1ins1011;1000A>G;1305C>T n/a
3 TRCN0000475908 GCCCGTTTAGAATTCAGGCAAGCG pLX_317 10% 65.9% 65.9% V5 0_1ins1011;1000A>G;1305C>T n/a
Download CSV