Transcript: Human XM_017017754.2

PREDICTED: Homo sapiens arrestin beta 1 (ARRB1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARRB1 (408)
Length:
7401
CDS:
56..1360

Additional Resources:

NCBI RefSeq record:
XM_017017754.2
NBCI Gene record:
ARRB1 (408)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230148 AGATCTCAGTGCGCCAGTATG pLKO_005 750 CDS 100% 10.800 15.120 N ARRB1 n/a
2 TRCN0000230150 GGTCCCAGGTGGTTAACAAAG pLKO_005 1764 3UTR 100% 10.800 15.120 N ARRB1 n/a
3 TRCN0000005160 CCTAGCCAATAACCGAGAGAA pLKO.1 886 CDS 100% 4.950 6.930 N ARRB1 n/a
4 TRCN0000005159 GCCAGTAGATACCAATCTCAT pLKO.1 1141 CDS 100% 4.950 6.930 N ARRB1 n/a
5 TRCN0000230147 TCTGGATAAGGAGATCTATTA pLKO_005 661 CDS 100% 13.200 9.240 N ARRB1 n/a
6 TRCN0000230149 GAACTGCCCTTCACCCTAATG pLKO_005 1067 CDS 100% 10.800 7.560 N ARRB1 n/a
7 TRCN0000005162 GAGATCTATTACCATGGAGAA pLKO.1 671 CDS 100% 4.050 2.835 N ARRB1 n/a
8 TRCN0000005163 GCTCACCGTCTACCTGGGAAA pLKO.1 106 CDS 100% 1.350 0.945 N ARRB1 n/a
9 TRCN0000005161 CACCTTTGAGATCCCTCCAAA pLKO.1 400 CDS 100% 4.950 2.970 N ARRB1 n/a
10 TRCN0000075646 GACATTGTATTTGAGGACTTT pLKO.1 1256 CDS 100% 4.950 2.970 N Arrb1 n/a
11 TRCN0000327472 GACATTGTATTTGAGGACTTT pLKO_005 1256 CDS 100% 4.950 2.970 N Arrb1 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6303 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00106 pDONR223 100% 92.7% 92.7% None 997_998ins24;1122_1193del n/a
2 ccsbBroad304_00106 pLX_304 0% 92.7% 92.7% V5 997_998ins24;1122_1193del n/a
3 TRCN0000471594 GGTGCGTGGTTTCTTTATATCATA pLX_317 29.6% 92.7% 92.7% V5 997_998ins24;1122_1193del n/a
Download CSV