Transcript: Human XM_017017761.2

PREDICTED: Homo sapiens melanoma cell adhesion molecule (MCAM), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCAM (4162)
Length:
5979
CDS:
30..1844

Additional Resources:

NCBI RefSeq record:
XM_017017761.2
NBCI Gene record:
MCAM (4162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375735 TACATCGATCTGAGGCATTAG pLKO_005 1832 CDS 100% 10.800 15.120 N Mcam n/a
2 TRCN0000155692 CCATTCCTCAAGTCATCTGGT pLKO.1 532 CDS 100% 2.640 3.696 N MCAM n/a
3 TRCN0000154854 GATGGCATTCAAGGAGAGGAA pLKO.1 1325 CDS 100% 2.640 2.112 N MCAM n/a
4 TRCN0000281976 GATGGCATTCAAGGAGAGGAA pLKO_005 1325 CDS 100% 2.640 2.112 N MCAM n/a
5 TRCN0000275792 CACACATTATGGCTGTAAATA pLKO_005 2152 3UTR 100% 15.000 10.500 N MCAM n/a
6 TRCN0000275791 AGGAACTACTGGTGAACTATG pLKO_005 1036 CDS 100% 10.800 7.560 N MCAM n/a
7 TRCN0000152241 CAGCTGGTTAAAGAAGACAAA pLKO.1 660 CDS 100% 4.950 3.465 N MCAM n/a
8 TRCN0000151337 GTGTTGAATCTGTCTTGTGAA pLKO.1 1368 CDS 100% 4.950 3.465 N MCAM n/a
9 TRCN0000156020 CTCATGTTGAAGTGCGCTGTT pLKO.1 2293 3UTR 100% 4.050 2.835 N MCAM n/a
10 TRCN0000275793 TTCCTGGAGCTGGTCAATTTA pLKO_005 1566 CDS 100% 15.000 9.000 N MCAM n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2487 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2488 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06567 pDONR223 100% 93.4% 92.5% None 1793_1794ins118;1812_1813insTGAGGCAT n/a
2 ccsbBroad304_06567 pLX_304 0% 93.4% 92.5% V5 1793_1794ins118;1812_1813insTGAGGCAT n/a
3 TRCN0000467432 TCCCGCCCTTTGAACTGACGTCCA pLX_317 17% 93.4% 92.5% V5 1793_1794ins118;1812_1813insTGAGGCAT n/a
Download CSV